Mutagenetix > Incidental Mutation

Incidental Mutation 'R5144:Pik3c2a'

395048

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2a

Ensembl Gene

ENSMUSG00000030660

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha

Synonyms

PI3KC2

MMRRC Submission

042728-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5144 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115936500-116042684 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115950021 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1332 (N1332S)

Ref Sequence

ENSEMBL: ENSMUSP00000146181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000206219]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000170430
AA Change: N1332S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: N1332S

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
low complexity region	361	372	N/A	INTRINSIC
PI3K_rbd	410	513	3.08e-38	SMART
PI3K_C2	674	783	2.71e-34	SMART
PI3Ka	860	1047	3.62e-85	SMART
PI3Kc	1134	1396	3.1e-125	SMART
PX	1422	1534	5.68e-30	SMART
C2	1573	1677	3.93e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000206219
AA Change: N1332S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

Predicted Effect

probably benign
Transcript: ENSMUST00000206385

Meta Mutation Damage Score

0.1621

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	T	A	2: 68,446,604 (GRCm39)		probably benign	Het
Arpc2	A	T	1: 74,287,367 (GRCm39)	K62N	probably damaging	Het
B4galt5	C	T	2: 167,148,516 (GRCm39)	E201K	possibly damaging	Het
Bub1b	C	T	2: 118,445,980 (GRCm39)	T334M	possibly damaging	Het
Ccdc71	T	C	9: 108,341,051 (GRCm39)	V288A	probably benign	Het
Cep350	G	A	1: 155,786,896 (GRCm39)	R1444W	probably damaging	Het
Chrna4	A	G	2: 180,666,623 (GRCm39)	L605P	probably damaging	Het
Col6a5	T	A	9: 105,766,482 (GRCm39)	I1813F	probably damaging	Het
Col9a1	A	G	1: 24,278,434 (GRCm39)	I821V	probably benign	Het
D430041D05Rik	T	C	2: 104,088,847 (GRCm39)	D43G	probably damaging	Het
Depdc7	T	C	2: 104,560,598 (GRCm39)	Y132C	probably damaging	Het
Dppa2	T	C	16: 48,137,666 (GRCm39)	V216A	probably damaging	Het
Ect2l	A	T	10: 18,020,325 (GRCm39)	N598K	probably benign	Het
Eif3c	T	C	7: 126,162,238 (GRCm39)	T195A	probably benign	Het
Epg5	T	C	18: 78,058,895 (GRCm39)	V1883A	probably damaging	Het
Ino80c	T	A	18: 24,241,935 (GRCm39)	D150V	probably benign	Het
Kcnb1	T	A	2: 166,947,864 (GRCm39)	Y328F	probably damaging	Het
Kcnj3	G	A	2: 55,337,059 (GRCm39)		probably null	Het
Ncor1	T	G	11: 62,240,290 (GRCm39)	S894R	probably damaging	Het
Nlgn3	G	A	X: 100,361,891 (GRCm39)	V287I	probably benign	Het
Nod2	T	C	8: 89,379,694 (GRCm39)	V72A	probably damaging	Het
Nudt19	T	C	7: 35,254,650 (GRCm39)	T194A	probably benign	Het
Or1j4	A	T	2: 36,740,156 (GRCm39)	T33S	probably benign	Het
Or8b53	C	T	9: 38,667,689 (GRCm39)	S235L	possibly damaging	Het
Pappa2	T	A	1: 158,784,703 (GRCm39)	R102S	probably benign	Het
Plppr1	T	A	4: 49,319,800 (GRCm39)	V142E	possibly damaging	Het
Prdm6	C	A	18: 53,598,110 (GRCm39)		probably benign	Het
Prm2	T	A	16: 10,609,732 (GRCm39)		probably benign	Het
Prmt3	T	C	7: 49,435,883 (GRCm39)	S155P	possibly damaging	Het
Rars2	T	C	4: 34,656,793 (GRCm39)	Y481H	probably benign	Het
Rgs2	G	A	1: 143,877,437 (GRCm39)	T206M	probably benign	Het
Slc2a8	C	T	2: 32,871,785 (GRCm39)	R56H	probably damaging	Het
Spmip11	C	A	15: 98,483,148 (GRCm39)		probably null	Het
Stk35	T	A	2: 129,652,855 (GRCm39)	M452K	probably damaging	Het
Tcf3	G	A	10: 80,251,071 (GRCm39)	H454Y	probably damaging	Het
Tgm3	C	T	2: 129,890,202 (GRCm39)	S655F	possibly damaging	Het
Tssc4	T	G	7: 142,623,770 (GRCm39)	L26R	probably damaging	Het
Utp11	A	T	4: 124,572,695 (GRCm39)		probably benign	Het
Vmn1r237	C	G	17: 21,534,688 (GRCm39)	A137G	possibly damaging	Het
Vmn2r129	G	T	4: 156,686,692 (GRCm39)		noncoding transcript	Het
Vps8	T	C	16: 21,378,103 (GRCm39)	L1038P	probably damaging	Het
Wipf3	C	T	6: 54,462,660 (GRCm39)	A290V	probably damaging	Het
Zdhhc25	T	G	15: 88,485,259 (GRCm39)	L198R	probably damaging	Het
Zdhhc6	A	T	19: 55,302,998 (GRCm39)	M1K	probably null	Het

Other mutations in Pik3c2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Pik3c2a	APN	7	115,975,518 (GRCm39)	missense	possibly damaging	0.50
IGL00732:Pik3c2a	APN	7	115,963,735 (GRCm39)	missense	possibly damaging	0.82
IGL01303:Pik3c2a	APN	7	115,973,038 (GRCm39)	missense	possibly damaging	0.94
IGL01443:Pik3c2a	APN	7	116,017,429 (GRCm39)	missense	probably benign	0.01
IGL01462:Pik3c2a	APN	7	115,975,485 (GRCm39)	missense	possibly damaging	0.94
IGL01641:Pik3c2a	APN	7	115,950,000 (GRCm39)	intron	probably benign
IGL01695:Pik3c2a	APN	7	116,016,753 (GRCm39)	missense	possibly damaging	0.82
IGL02095:Pik3c2a	APN	7	115,945,423 (GRCm39)	missense	probably damaging	1.00
IGL02137:Pik3c2a	APN	7	115,950,039 (GRCm39)	missense	probably benign	0.00
IGL02160:Pik3c2a	APN	7	115,987,299 (GRCm39)	missense	probably damaging	1.00
IGL02224:Pik3c2a	APN	7	115,962,575 (GRCm39)	splice site	probably benign
IGL02345:Pik3c2a	APN	7	116,005,126 (GRCm39)	missense	probably damaging	1.00
IGL02644:Pik3c2a	APN	7	115,972,049 (GRCm39)	missense	probably benign	0.00
IGL02756:Pik3c2a	APN	7	115,963,748 (GRCm39)	missense	probably benign	0.01
IGL03339:Pik3c2a	APN	7	116,017,256 (GRCm39)	missense	possibly damaging	0.57
IGL03412:Pik3c2a	APN	7	116,017,074 (GRCm39)	missense	probably benign	0.21
R0046:Pik3c2a	UTSW	7	115,953,307 (GRCm39)	missense	probably damaging	1.00
R0387:Pik3c2a	UTSW	7	115,972,979 (GRCm39)	missense	probably damaging	1.00
R0501:Pik3c2a	UTSW	7	115,953,290 (GRCm39)	missense	probably damaging	1.00
R0650:Pik3c2a	UTSW	7	115,945,482 (GRCm39)	splice site	probably benign
R0991:Pik3c2a	UTSW	7	115,961,280 (GRCm39)	critical splice donor site	probably null
R1074:Pik3c2a	UTSW	7	115,950,160 (GRCm39)	nonsense	probably null
R1485:Pik3c2a	UTSW	7	116,016,908 (GRCm39)	missense	possibly damaging	0.50
R1495:Pik3c2a	UTSW	7	115,987,300 (GRCm39)	missense	probably benign	0.01
R1510:Pik3c2a	UTSW	7	115,987,280 (GRCm39)	missense	probably benign	0.00
R1654:Pik3c2a	UTSW	7	115,968,083 (GRCm39)	missense	probably benign	0.02
R1711:Pik3c2a	UTSW	7	116,017,162 (GRCm39)	nonsense	probably null
R1733:Pik3c2a	UTSW	7	116,017,755 (GRCm39)	start codon destroyed	possibly damaging	0.96
R1751:Pik3c2a	UTSW	7	115,945,471 (GRCm39)	missense	probably damaging	0.98
R1812:Pik3c2a	UTSW	7	116,016,899 (GRCm39)	missense	probably damaging	0.98
R1817:Pik3c2a	UTSW	7	115,975,747 (GRCm39)	critical splice donor site	probably null
R1826:Pik3c2a	UTSW	7	115,967,352 (GRCm39)	missense	probably benign
R1875:Pik3c2a	UTSW	7	116,017,206 (GRCm39)	missense	probably benign	0.35
R1995:Pik3c2a	UTSW	7	115,953,241 (GRCm39)	missense	probably damaging	1.00
R2007:Pik3c2a	UTSW	7	115,941,472 (GRCm39)	missense	probably damaging	1.00
R2009:Pik3c2a	UTSW	7	115,963,738 (GRCm39)	missense	probably damaging	1.00
R2013:Pik3c2a	UTSW	7	115,950,166 (GRCm39)	critical splice acceptor site	probably null
R2014:Pik3c2a	UTSW	7	115,950,166 (GRCm39)	critical splice acceptor site	probably null
R2015:Pik3c2a	UTSW	7	115,950,166 (GRCm39)	critical splice acceptor site	probably null
R2027:Pik3c2a	UTSW	7	115,950,057 (GRCm39)	missense	probably damaging	1.00
R2050:Pik3c2a	UTSW	7	116,016,686 (GRCm39)	critical splice donor site	probably null
R2068:Pik3c2a	UTSW	7	115,972,126 (GRCm39)	nonsense	probably null
R3814:Pik3c2a	UTSW	7	115,947,414 (GRCm39)	missense	probably damaging	1.00
R3848:Pik3c2a	UTSW	7	115,963,785 (GRCm39)	nonsense	probably null
R4386:Pik3c2a	UTSW	7	115,953,334 (GRCm39)	missense	probably damaging	1.00
R4668:Pik3c2a	UTSW	7	115,957,923 (GRCm39)	missense	probably benign	0.16
R4783:Pik3c2a	UTSW	7	116,017,060 (GRCm39)	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	115,939,391 (GRCm39)	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	115,939,391 (GRCm39)	missense	probably damaging	1.00
R5057:Pik3c2a	UTSW	7	115,975,518 (GRCm39)	missense	possibly damaging	0.50
R5080:Pik3c2a	UTSW	7	115,947,509 (GRCm39)	missense	probably damaging	1.00
R5083:Pik3c2a	UTSW	7	115,941,636 (GRCm39)	missense	probably damaging	1.00
R5589:Pik3c2a	UTSW	7	116,016,893 (GRCm39)	missense	probably benign	0.02
R5646:Pik3c2a	UTSW	7	116,005,186 (GRCm39)	missense	probably damaging	1.00
R5829:Pik3c2a	UTSW	7	115,972,049 (GRCm39)	missense	probably benign	0.00
R5951:Pik3c2a	UTSW	7	115,967,419 (GRCm39)	missense	probably damaging	0.96
R5958:Pik3c2a	UTSW	7	115,961,799 (GRCm39)	missense	probably damaging	1.00
R6356:Pik3c2a	UTSW	7	115,947,440 (GRCm39)	missense	possibly damaging	0.46
R6551:Pik3c2a	UTSW	7	116,016,731 (GRCm39)	missense	probably damaging	0.97
R6641:Pik3c2a	UTSW	7	115,939,460 (GRCm39)	critical splice acceptor site	probably null
R6661:Pik3c2a	UTSW	7	115,967,993 (GRCm39)	missense	possibly damaging	0.77
R6789:Pik3c2a	UTSW	7	115,961,419 (GRCm39)	missense	probably damaging	1.00
R6874:Pik3c2a	UTSW	7	115,993,540 (GRCm39)	missense	probably damaging	1.00
R6985:Pik3c2a	UTSW	7	116,017,223 (GRCm39)	missense	probably damaging	0.98
R7106:Pik3c2a	UTSW	7	116,017,368 (GRCm39)	nonsense	probably null
R7153:Pik3c2a	UTSW	7	115,941,487 (GRCm39)	missense	probably damaging	1.00
R7176:Pik3c2a	UTSW	7	115,987,331 (GRCm39)	missense	possibly damaging	0.47
R7265:Pik3c2a	UTSW	7	115,987,321 (GRCm39)	missense	probably damaging	1.00
R7303:Pik3c2a	UTSW	7	116,005,178 (GRCm39)	missense	probably benign	0.00
R7308:Pik3c2a	UTSW	7	115,973,074 (GRCm39)	missense	probably damaging	1.00
R7375:Pik3c2a	UTSW	7	115,975,621 (GRCm39)	missense	probably damaging	1.00
R7406:Pik3c2a	UTSW	7	115,953,242 (GRCm39)	missense	probably damaging	1.00
R7426:Pik3c2a	UTSW	7	115,972,089 (GRCm39)	missense	probably damaging	1.00
R7528:Pik3c2a	UTSW	7	115,993,474 (GRCm39)	missense	probably damaging	1.00
R7539:Pik3c2a	UTSW	7	115,939,331 (GRCm39)	missense	probably damaging	0.97
R7684:Pik3c2a	UTSW	7	115,987,312 (GRCm39)	nonsense	probably null
R7737:Pik3c2a	UTSW	7	115,955,488 (GRCm39)	missense	probably damaging	0.99
R7739:Pik3c2a	UTSW	7	115,993,529 (GRCm39)	missense	probably benign	0.26
R7852:Pik3c2a	UTSW	7	116,016,693 (GRCm39)	missense	probably benign
R7922:Pik3c2a	UTSW	7	115,990,517 (GRCm39)	missense	probably damaging	1.00
R7956:Pik3c2a	UTSW	7	115,949,350 (GRCm39)	missense	probably benign	0.01
R8005:Pik3c2a	UTSW	7	116,017,271 (GRCm39)	missense	probably damaging	1.00
R8158:Pik3c2a	UTSW	7	115,942,232 (GRCm39)	missense	probably benign	0.00
R8329:Pik3c2a	UTSW	7	116,017,283 (GRCm39)	missense	probably damaging	1.00
R8478:Pik3c2a	UTSW	7	116,017,584 (GRCm39)	missense	probably damaging	0.96
R8736:Pik3c2a	UTSW	7	115,975,464 (GRCm39)	missense	possibly damaging	0.47
R8812:Pik3c2a	UTSW	7	115,951,112 (GRCm39)	missense	probably damaging	1.00
R8922:Pik3c2a	UTSW	7	116,017,659 (GRCm39)	missense	probably damaging	1.00
R8953:Pik3c2a	UTSW	7	115,987,320 (GRCm39)	missense	probably benign	0.19
R9105:Pik3c2a	UTSW	7	115,972,049 (GRCm39)	missense	probably benign	0.00
R9111:Pik3c2a	UTSW	7	115,993,531 (GRCm39)	missense	probably damaging	0.99
R9152:Pik3c2a	UTSW	7	116,017,004 (GRCm39)	missense	probably benign	0.30
R9241:Pik3c2a	UTSW	7	116,017,115 (GRCm39)	missense	probably benign	0.02
R9301:Pik3c2a	UTSW	7	115,945,413 (GRCm39)	missense	probably damaging	1.00
R9325:Pik3c2a	UTSW	7	115,990,558 (GRCm39)	missense	probably damaging	0.99
R9482:Pik3c2a	UTSW	7	115,961,289 (GRCm39)	missense	probably benign	0.04
R9513:Pik3c2a	UTSW	7	115,939,321 (GRCm39)	missense	probably benign	0.06
R9569:Pik3c2a	UTSW	7	115,957,939 (GRCm39)	missense	possibly damaging	0.89
R9758:Pik3c2a	UTSW	7	115,945,427 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACATTGGGGATTCATAGCTGTAATC -3'
(R):5'- TGTCACAGCTCACATGGCTTC -3'

Sequencing Primer
(F):5'- CATTTTGTGACTACAGCCA -3'
(R):5'- TGTGTGTCTATAAATATGCCCTCTG -3'

Posted On

2016-06-21