Incidental Mutation 'R5145:Meig1'
ID395070
Institutional Source Beutler Lab
Gene Symbol Meig1
Ensembl Gene ENSMUSG00000026650
Gene Namemeiosis expressed gene 1
SynonymsMeg1
MMRRC Submission 042729-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5145 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location3409043-3422648 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3409226 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 79 (E79G)
Ref Sequence ENSEMBL: ENSMUSP00000110736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064685] [ENSMUST00000115081] [ENSMUST00000115082] [ENSMUST00000115083] [ENSMUST00000115084] [ENSMUST00000144584]
Predicted Effect probably damaging
Transcript: ENSMUST00000064685
AA Change: E79G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070310
Gene: ENSMUSG00000026650
AA Change: E79G

DomainStartEndE-ValueType
Pfam:Meiosis_expr 11 87 1.4e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115081
AA Change: E79G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110733
Gene: ENSMUSG00000026650
AA Change: E79G

DomainStartEndE-ValueType
Pfam:Meiosis_expr 11 86 6.3e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115082
AA Change: E79G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110734
Gene: ENSMUSG00000026650
AA Change: E79G

DomainStartEndE-ValueType
Pfam:Meiosis_expr 11 87 1.4e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115083
AA Change: E79G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110735
Gene: ENSMUSG00000026650
AA Change: E79G

DomainStartEndE-ValueType
Pfam:Meiosis_expr 11 87 1.4e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115084
AA Change: E79G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110736
Gene: ENSMUSG00000026650
AA Change: E79G

DomainStartEndE-ValueType
Pfam:Meiosis_expr 11 87 1.4e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144584
SMART Domains Protein: ENSMUSP00000123118
Gene: ENSMUSG00000026650

DomainStartEndE-ValueType
Pfam:Meiosis_expr 11 65 6.1e-29 PFAM
Meta Mutation Damage Score 0.0952 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male sterility with arrested spermatogenesis, absent sperm flagellum, and deformed sperm heads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 G A 15: 11,285,876 G724R probably damaging Het
Adgrg7 T A 16: 56,742,319 I552L probably benign Het
Ankrd11 A G 8: 122,891,204 probably benign Het
Col12a1 T C 9: 79,706,300 T88A probably benign Het
Col6a5 T G 9: 105,934,245 I692L unknown Het
Cry2 T C 2: 92,413,060 I479V probably benign Het
Ddx21 T C 10: 62,587,539 probably null Het
Efcab12 T A 6: 115,823,277 I262F probably damaging Het
Eif2ak2 T C 17: 78,876,204 D72G possibly damaging Het
Fry T C 5: 150,370,224 F461L probably damaging Het
Gm38706 G A 6: 130,483,768 noncoding transcript Het
Gm9772 C T 17: 22,007,126 C59Y probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mfsd2b T A 12: 4,865,908 probably benign Het
Nfatc2 A C 2: 168,590,067 I42S probably benign Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Npy6r C T 18: 44,276,619 T369I probably benign Het
Olfr1352 A G 10: 78,984,309 E173G probably benign Het
Ptprb A G 10: 116,343,915 T1413A probably benign Het
Ptprc A G 1: 138,089,566 S624P probably benign Het
Pum3 A G 19: 27,399,769 V441A probably damaging Het
Ranbp2 T A 10: 58,480,038 D2193E probably damaging Het
Rbl1 A T 2: 157,175,477 probably benign Het
Rnf167 T C 11: 70,650,080 probably benign Het
Sdr9c7 T C 10: 127,902,390 V179A probably damaging Het
Sema3c A G 5: 17,727,617 N706S possibly damaging Het
Stt3a T C 9: 36,735,466 Y617C probably damaging Het
Tdrd6 T A 17: 43,626,075 S1361C probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Tti1 G A 2: 158,008,512 A269V probably benign Het
Ugt2a1 A G 5: 87,486,027 probably null Het
Vmn2r10 T C 5: 108,995,895 T730A possibly damaging Het
Other mutations in Meig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Meig1 APN 2 3409274 missense probably damaging 1.00
IGL01311:Meig1 APN 2 3409208 missense possibly damaging 0.78
IGL02329:Meig1 APN 2 3409251 missense probably damaging 0.97
IGL02730:Meig1 APN 2 3411910 missense probably damaging 1.00
R1119:Meig1 UTSW 2 3409274 missense probably damaging 1.00
R1681:Meig1 UTSW 2 3409274 missense probably damaging 1.00
R2155:Meig1 UTSW 2 3409253 missense probably benign 0.08
R4387:Meig1 UTSW 2 3409241 missense probably damaging 1.00
R4787:Meig1 UTSW 2 3409214 missense possibly damaging 0.95
R4814:Meig1 UTSW 2 3411922 missense probably benign 0.14
R5694:Meig1 UTSW 2 3411962 missense probably damaging 0.99
R7843:Meig1 UTSW 2 3409211 missense probably damaging 1.00
R7926:Meig1 UTSW 2 3409211 missense probably damaging 1.00
R8061:Meig1 UTSW 2 3409203 missense not run
Predicted Primers PCR Primer
(F):5'- GGCCAGATCCTAAGGTTCTCAG -3'
(R):5'- CAAATTGTCAGACGGTGAAACG -3'

Sequencing Primer
(F):5'- CTGGACAATTCAAGGTTTCAAGGTG -3'
(R):5'- CGTGACGTAAAATCATACTAGCGTG -3'
Posted On2016-06-21