Incidental Mutation 'R5145:Cry2'
ID 395071
Institutional Source Beutler Lab
Gene Symbol Cry2
Ensembl Gene ENSMUSG00000068742
Gene Name cryptochrome circadian regulator 2
Synonyms D130054K12Rik
MMRRC Submission 042729-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.540) question?
Stock # R5145 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 92233991-92264388 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92243405 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 479 (I479V)
Ref Sequence ENSEMBL: ENSMUSP00000106909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090559] [ENSMUST00000111278]
AlphaFold Q9R194
Predicted Effect probably benign
Transcript: ENSMUST00000090559
AA Change: I479V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088047
Gene: ENSMUSG00000068742
AA Change: I479V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 187 2.4e-50 PFAM
Pfam:FAD_binding_7 231 504 4.4e-89 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111278
AA Change: I479V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106909
Gene: ENSMUSG00000068742
AA Change: I479V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 189 3.6e-50 PFAM
Pfam:FAD_binding_7 230 506 1.4e-105 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126002
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour longer circadian period under constant darkness, and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 G A 15: 11,285,962 (GRCm39) G724R probably damaging Het
Adgrg7 T A 16: 56,562,682 (GRCm39) I552L probably benign Het
Ankrd11 A G 8: 123,617,943 (GRCm39) probably benign Het
Col12a1 T C 9: 79,613,582 (GRCm39) T88A probably benign Het
Col6a5 T G 9: 105,811,444 (GRCm39) I692L unknown Het
Ddx21 T C 10: 62,423,318 (GRCm39) probably null Het
Efcab12 T A 6: 115,800,238 (GRCm39) I262F probably damaging Het
Eif2ak2 T C 17: 79,183,633 (GRCm39) D72G possibly damaging Het
Fry T C 5: 150,293,689 (GRCm39) F461L probably damaging Het
Gm38706 G A 6: 130,460,731 (GRCm39) noncoding transcript Het
Gm9772 C T 17: 22,226,107 (GRCm39) C59Y probably damaging Het
Meig1 T C 2: 3,410,263 (GRCm39) E79G probably damaging Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Mfsd2b T A 12: 4,915,908 (GRCm39) probably benign Het
Nfatc2 A C 2: 168,431,987 (GRCm39) I42S probably benign Het
Nlgn3 G A X: 100,361,891 (GRCm39) V287I probably benign Het
Npy6r C T 18: 44,409,686 (GRCm39) T369I probably benign Het
Or7a36 A G 10: 78,820,143 (GRCm39) E173G probably benign Het
Ptprb A G 10: 116,179,820 (GRCm39) T1413A probably benign Het
Ptprc A G 1: 138,017,304 (GRCm39) S624P probably benign Het
Pum3 A G 19: 27,377,169 (GRCm39) V441A probably damaging Het
Ranbp2 T A 10: 58,315,860 (GRCm39) D2193E probably damaging Het
Rbl1 A T 2: 157,017,397 (GRCm39) probably benign Het
Rnf167 T C 11: 70,540,906 (GRCm39) probably benign Het
Sdr9c7 T C 10: 127,738,259 (GRCm39) V179A probably damaging Het
Sema3c A G 5: 17,932,615 (GRCm39) N706S possibly damaging Het
Stt3a T C 9: 36,646,762 (GRCm39) Y617C probably damaging Het
Tdrd6 T A 17: 43,936,966 (GRCm39) S1361C probably damaging Het
Tha1 A C 11: 117,760,502 (GRCm39) S241A probably damaging Het
Tti1 G A 2: 157,850,432 (GRCm39) A269V probably benign Het
Ugt2a1 A G 5: 87,633,886 (GRCm39) probably null Het
Vmn2r10 T C 5: 109,143,761 (GRCm39) T730A possibly damaging Het
Other mutations in Cry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Cry2 APN 2 92,254,977 (GRCm39) missense probably benign 0.15
IGL02167:Cry2 APN 2 92,264,166 (GRCm39) missense possibly damaging 0.93
IGL02183:Cry2 APN 2 92,243,384 (GRCm39) missense probably damaging 0.99
IGL02343:Cry2 APN 2 92,257,266 (GRCm39) missense possibly damaging 0.90
IGL02432:Cry2 APN 2 92,244,012 (GRCm39) missense probably damaging 0.99
IGL02725:Cry2 APN 2 92,243,605 (GRCm39) splice site probably benign
IGL02932:Cry2 APN 2 92,243,462 (GRCm39) nonsense probably null
IGL03122:Cry2 APN 2 92,243,640 (GRCm39) missense probably damaging 1.00
IGL03366:Cry2 APN 2 92,244,060 (GRCm39) missense probably damaging 1.00
R0679:Cry2 UTSW 2 92,244,060 (GRCm39) missense probably damaging 1.00
R1325:Cry2 UTSW 2 92,244,115 (GRCm39) missense probably damaging 1.00
R1862:Cry2 UTSW 2 92,254,911 (GRCm39) missense probably damaging 1.00
R1891:Cry2 UTSW 2 92,243,985 (GRCm39) missense possibly damaging 0.93
R2189:Cry2 UTSW 2 92,242,037 (GRCm39) missense possibly damaging 0.84
R4032:Cry2 UTSW 2 92,244,172 (GRCm39) missense probably benign 0.00
R4689:Cry2 UTSW 2 92,254,899 (GRCm39) missense probably benign 0.38
R5130:Cry2 UTSW 2 92,254,944 (GRCm39) missense probably benign 0.28
R5970:Cry2 UTSW 2 92,243,312 (GRCm39) missense probably benign 0.08
R6179:Cry2 UTSW 2 92,244,187 (GRCm39) missense probably damaging 0.98
R7102:Cry2 UTSW 2 92,243,438 (GRCm39) missense probably damaging 0.99
R7158:Cry2 UTSW 2 92,244,060 (GRCm39) missense probably damaging 1.00
R7213:Cry2 UTSW 2 92,244,004 (GRCm39) missense probably benign 0.00
R7257:Cry2 UTSW 2 92,243,326 (GRCm39) missense possibly damaging 0.67
R7378:Cry2 UTSW 2 92,244,009 (GRCm39) missense probably damaging 1.00
R7427:Cry2 UTSW 2 92,243,392 (GRCm39) missense possibly damaging 0.74
R7428:Cry2 UTSW 2 92,243,392 (GRCm39) missense possibly damaging 0.74
R7440:Cry2 UTSW 2 92,243,983 (GRCm39) missense probably damaging 1.00
R7531:Cry2 UTSW 2 92,243,350 (GRCm39) missense probably damaging 0.98
R8234:Cry2 UTSW 2 92,242,974 (GRCm39) missense probably benign
R8350:Cry2 UTSW 2 92,244,286 (GRCm39) missense probably benign 0.00
R8450:Cry2 UTSW 2 92,244,286 (GRCm39) missense probably benign 0.00
R8496:Cry2 UTSW 2 92,257,284 (GRCm39) missense probably damaging 1.00
R9172:Cry2 UTSW 2 92,243,993 (GRCm39) missense probably damaging 1.00
R9283:Cry2 UTSW 2 92,244,249 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCATCTTTTACAGCCTGGGG -3'
(R):5'- CAGACTCTTTGGCTCTGGAG -3'

Sequencing Primer
(F):5'- GCCAACACCTGAAAAAGCTTTC -3'
(R):5'- AGCCTCCCTCCTGGATTGG -3'
Posted On 2016-06-21