Mutagenetix > Incidental Mutation

Incidental Mutation 'R5145:Ugt2a1'

395076

Institutional Source

Beutler Lab

Gene Symbol

Ugt2a1

Ensembl Gene

ENSMUSG00000106677

Gene Name

UDP glucuronosyltransferase 2 family, polypeptide A1

Synonyms

MMRRC Submission

042729-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R5145 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87607349-87638730 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 87633886 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000143986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079811] [ENSMUST00000144144] [ENSMUST00000147854] [ENSMUST00000147854] [ENSMUST00000147854] [ENSMUST00000201519] [ENSMUST00000201519] [ENSMUST00000201519]

AlphaFold

Q80X89

Predicted Effect

probably benign
Transcript: ENSMUST00000079811

SMART Domains

Protein: ENSMUSP00000078740
Gene: ENSMUSG00000029268

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:UDPGT	22	525	3.5e-233	PFAM
Pfam:Glyco_tran_28_C	332	453	1.4e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000144144

SMART Domains

Protein: ENSMUSP00000114842
Gene: ENSMUSG00000029268

Domain	Start	End	E-Value	Type
Pfam:UDPGT	1	277	2.3e-168	PFAM
Pfam:Glyco_tran_28_C	100	203	7.4e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000147854

SMART Domains

Protein: ENSMUSP00000114583
Gene: ENSMUSG00000106677

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:UDPGT	21	525	1.2e-235	PFAM
Pfam:Glyco_tran_28_C	332	453	1.4e-8	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000147854

SMART Domains

Protein: ENSMUSP00000114583
Gene: ENSMUSG00000106677

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:UDPGT	21	525	1.2e-235	PFAM
Pfam:Glyco_tran_28_C	332	453	1.4e-8	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000147854

SMART Domains

Protein: ENSMUSP00000114583
Gene: ENSMUSG00000106677

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:UDPGT	21	525	1.2e-235	PFAM
Pfam:Glyco_tran_28_C	332	453	1.4e-8	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000201519

SMART Domains

Protein: ENSMUSP00000143986
Gene: ENSMUSG00000107180

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:UDPGT	21	240	2.3e-54	PFAM
Pfam:UDPGT	236	499	2.9e-75	PFAM
Pfam:UDPGT	498	691	2.6e-116	PFAM
Pfam:Glyco_tran_28_C	512	618	3.1e-6	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000201519

SMART Domains

Protein: ENSMUSP00000143986
Gene: ENSMUSG00000107180

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:UDPGT	21	240	2.3e-54	PFAM
Pfam:UDPGT	236	499	2.9e-75	PFAM
Pfam:UDPGT	498	691	2.6e-116	PFAM
Pfam:Glyco_tran_28_C	512	618	3.1e-6	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000201519

SMART Domains

Protein: ENSMUSP00000143986
Gene: ENSMUSG00000107180

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:UDPGT	21	240	2.3e-54	PFAM
Pfam:UDPGT	236	499	2.9e-75	PFAM
Pfam:UDPGT	498	691	2.6e-116	PFAM
Pfam:Glyco_tran_28_C	512	618	3.1e-6	PFAM

Meta Mutation Damage Score

0.9492

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UDP-glycosyltransferase family, members of which catalyze biotransformation reactions in which lipophilic substrates are conjugated with glucuronic acid to increase water solubility and enhance excretion. They are of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. This enzyme is expressed in the olfactory neuroepithelium, which lines the posterior nasal cavity and is exposed to a wide range of odorants and airborne toxic compounds. Hence, this protein has been suggested to be involved in clearing lipophilic odorant molecules from the sensory epithelium. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. This gene shares exon structure with the UDP glucuronosyltransferase 2A2 family member, which encodes N-terminally distinct isoforms. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts12	G	A	15: 11,285,962 (GRCm39)	G724R	probably damaging	Het
Adgrg7	T	A	16: 56,562,682 (GRCm39)	I552L	probably benign	Het
Ankrd11	A	G	8: 123,617,943 (GRCm39)		probably benign	Het
Col12a1	T	C	9: 79,613,582 (GRCm39)	T88A	probably benign	Het
Col6a5	T	G	9: 105,811,444 (GRCm39)	I692L	unknown	Het
Cry2	T	C	2: 92,243,405 (GRCm39)	I479V	probably benign	Het
Ddx21	T	C	10: 62,423,318 (GRCm39)		probably null	Het
Efcab12	T	A	6: 115,800,238 (GRCm39)	I262F	probably damaging	Het
Eif2ak2	T	C	17: 79,183,633 (GRCm39)	D72G	possibly damaging	Het
Fry	T	C	5: 150,293,689 (GRCm39)	F461L	probably damaging	Het
Gm38706	G	A	6: 130,460,731 (GRCm39)		noncoding transcript	Het
Gm9772	C	T	17: 22,226,107 (GRCm39)	C59Y	probably damaging	Het
Meig1	T	C	2: 3,410,263 (GRCm39)	E79G	probably damaging	Het
Mfng	C	T	15: 78,648,588 (GRCm39)	R163H	probably benign	Het
Mfsd2b	T	A	12: 4,915,908 (GRCm39)		probably benign	Het
Nfatc2	A	C	2: 168,431,987 (GRCm39)	I42S	probably benign	Het
Nlgn3	G	A	X: 100,361,891 (GRCm39)	V287I	probably benign	Het
Npy6r	C	T	18: 44,409,686 (GRCm39)	T369I	probably benign	Het
Or7a36	A	G	10: 78,820,143 (GRCm39)	E173G	probably benign	Het
Ptprb	A	G	10: 116,179,820 (GRCm39)	T1413A	probably benign	Het
Ptprc	A	G	1: 138,017,304 (GRCm39)	S624P	probably benign	Het
Pum3	A	G	19: 27,377,169 (GRCm39)	V441A	probably damaging	Het
Ranbp2	T	A	10: 58,315,860 (GRCm39)	D2193E	probably damaging	Het
Rbl1	A	T	2: 157,017,397 (GRCm39)		probably benign	Het
Rnf167	T	C	11: 70,540,906 (GRCm39)		probably benign	Het
Sdr9c7	T	C	10: 127,738,259 (GRCm39)	V179A	probably damaging	Het
Sema3c	A	G	5: 17,932,615 (GRCm39)	N706S	possibly damaging	Het
Stt3a	T	C	9: 36,646,762 (GRCm39)	Y617C	probably damaging	Het
Tdrd6	T	A	17: 43,936,966 (GRCm39)	S1361C	probably damaging	Het
Tha1	A	C	11: 117,760,502 (GRCm39)	S241A	probably damaging	Het
Tti1	G	A	2: 157,850,432 (GRCm39)	A269V	probably benign	Het
Vmn2r10	T	C	5: 109,143,761 (GRCm39)	T730A	possibly damaging	Het

Other mutations in Ugt2a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0131:Ugt2a1	UTSW	5	87,622,720 (GRCm39)	nonsense	probably null
R4654:Ugt2a1	UTSW	5	87,634,083 (GRCm39)	missense	probably damaging	1.00
R4834:Ugt2a1	UTSW	5	87,633,894 (GRCm39)	splice site	probably null
R5540:Ugt2a1	UTSW	5	87,633,915 (GRCm39)	missense	probably damaging	1.00
R7692:Ugt2a1	UTSW	5	87,634,586 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGTTGGCCTATATAACAGAAGG -3'
(R):5'- TGGAAAGGTCCCATTCCCTC -3'

Sequencing Primer
(F):5'- TGGCCTATATAACAGAAGGCTAATG -3'
(R):5'- GAAAGGTCCCATTCCCTCCTTCC -3'

Posted On

2016-06-21