Incidental Mutation 'R0449:Ints11'
ID39508
Institutional Source Beutler Lab
Gene Symbol Ints11
Ensembl Gene ENSMUSG00000029034
Gene Nameintegrator complex subunit 11
Synonyms2410006F12Rik, Cpsf3l
MMRRC Submission 038649-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0449 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155869546-155889103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 155887948 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 463 (R463L)
Ref Sequence ENSEMBL: ENSMUSP00000030901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030901] [ENSMUST00000079031] [ENSMUST00000097737] [ENSMUST00000105584] [ENSMUST00000120794] [ENSMUST00000156460]
Predicted Effect probably benign
Transcript: ENSMUST00000030901
AA Change: R463L

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030901
Gene: ENSMUSG00000029034
AA Change: R463L

DomainStartEndE-ValueType
Lactamase_B 16 233 3.38e-17 SMART
Beta-Casp 245 363 6.94e-37 SMART
Pfam:RMMBL 376 418 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079031
SMART Domains Protein: ENSMUSP00000078040
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
PH 265 361 6.35e-16 SMART
low complexity region 377 391 N/A INTRINSIC
ArfGap 399 521 4.62e-56 SMART
low complexity region 554 566 N/A INTRINSIC
low complexity region 601 617 N/A INTRINSIC
low complexity region 628 650 N/A INTRINSIC
low complexity region 669 686 N/A INTRINSIC
ANK 696 725 3.91e-3 SMART
ANK 729 758 2.43e1 SMART
low complexity region 781 796 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097737
SMART Domains Protein: ENSMUSP00000095344
Gene: ENSMUSG00000051557

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 16 124 2.5e-12 PFAM
Pfam:PseudoU_synth_1 168 285 1.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105584
SMART Domains Protein: ENSMUSP00000101209
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
Pfam:BAR_3 3 236 4.1e-95 PFAM
PH 269 365 6.35e-16 SMART
low complexity region 381 395 N/A INTRINSIC
ArfGap 403 525 4.62e-56 SMART
low complexity region 558 570 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 673 690 N/A INTRINSIC
ANK 700 729 3.91e-3 SMART
ANK 733 762 2.43e1 SMART
low complexity region 785 800 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120794
AA Change: R441L

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112656
Gene: ENSMUSG00000029034
AA Change: R441L

DomainStartEndE-ValueType
Lactamase_B 16 211 6.42e-9 SMART
Beta-Casp 223 341 6.94e-37 SMART
Pfam:RMMBL 354 396 3.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150446
Predicted Effect probably benign
Transcript: ENSMUST00000156460
SMART Domains Protein: ENSMUSP00000118803
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
SCOP:d1smla_ 1 66 7e-7 SMART
PDB:2I7V|A 3 38 1e-9 PDB
Blast:Lactamase_B 16 66 4e-30 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Integrator complex contains at least 12 subunits and associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates the 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690). INTS11, or CPSF3L, is the catalytic subunit of the Integrator complex (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,939,885 R813* probably null Het
Accsl T A 2: 93,866,074 I60F probably benign Het
Adam29 C T 8: 55,872,681 G246D probably benign Het
Ankrd13c A G 3: 157,991,714 I319V probably benign Het
B020004J07Rik T C 4: 101,836,961 S242G probably benign Het
Bag6 T G 17: 35,141,466 V327G probably damaging Het
Barhl1 C T 2: 28,915,292 A130T probably benign Het
Bend4 T C 5: 67,398,240 D541G probably damaging Het
Birc6 A C 17: 74,692,295 T4673P probably damaging Het
Ccdc81 T C 7: 89,890,471 R186G probably damaging Het
Cdyl2 A G 8: 116,583,192 F342L probably damaging Het
Chd3 C A 11: 69,357,541 V748L probably damaging Het
CN725425 G T 15: 91,238,944 R72I possibly damaging Het
Col22a1 A G 15: 71,962,671 probably null Het
Cops3 A G 11: 59,818,417 probably null Het
Ctnnd1 G T 2: 84,603,262 Q940K possibly damaging Het
Dtnb C T 12: 3,591,971 Q45* probably null Het
Efr3a T A 15: 65,842,704 I280K probably damaging Het
Eml6 A C 11: 29,893,213 V167G probably benign Het
Fam83c T A 2: 155,830,295 M407L probably benign Het
Fasn T C 11: 120,811,068 T1862A probably benign Het
Fbxl6 A G 15: 76,535,955 I486T probably damaging Het
Gpr182 A G 10: 127,750,696 Y129H probably damaging Het
Gpr75 A G 11: 30,892,456 S454G probably damaging Het
Hectd4 G A 5: 121,364,590 probably null Het
Hsf4 A G 8: 105,275,590 T411A probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il4 A T 11: 53,618,605 M1K probably null Het
Ints4 G A 7: 97,529,223 E677K probably damaging Het
Klk1b11 G A 7: 43,997,792 C50Y probably damaging Het
Krt14 C A 11: 100,207,395 G21C unknown Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Lama3 A G 18: 12,500,512 probably null Het
Lrrk2 T C 15: 91,750,275 L1414P probably damaging Het
Matn2 T C 15: 34,428,541 S684P probably damaging Het
Mga T A 2: 119,941,381 V1574D probably damaging Het
Mia2 T C 12: 59,172,594 probably null Het
Mrpl21 T A 19: 3,292,459 probably benign Het
Msh5 T A 17: 35,041,482 Q266L probably benign Het
Mybpc1 C A 10: 88,540,960 C758F probably damaging Het
Myo15 G A 11: 60,509,596 A2932T possibly damaging Het
Nbas T A 12: 13,519,108 I2021K probably benign Het
Neurl4 T C 11: 69,905,567 S424P probably damaging Het
Olfr16 T A 1: 172,957,398 V201E probably damaging Het
Olfr322 A C 11: 58,665,963 I135L probably benign Het
Olfr782 A G 10: 129,351,234 M224V probably benign Het
Olfr829 T C 9: 18,856,649 M8T probably benign Het
Olfr850 T A 9: 19,478,092 I53F possibly damaging Het
Phlpp1 C T 1: 106,350,578 R907W probably damaging Het
Pigg T C 5: 108,336,411 V508A probably benign Het
Pkhd1l1 T G 15: 44,501,519 Y685D probably damaging Het
Polr3a A T 14: 24,484,466 I34N probably damaging Het
Prex1 A G 2: 166,569,377 V1434A probably benign Het
Ptprh T A 7: 4,598,006 D124V probably damaging Het
Rad54b T A 4: 11,606,131 I513N probably benign Het
Rbm12b1 A G 4: 12,145,507 N493S probably benign Het
Rfx7 A T 9: 72,610,304 probably null Het
Serpini1 A G 3: 75,613,341 K82E probably benign Het
Slc27a6 T G 18: 58,609,165 probably null Het
Slc35f2 G T 9: 53,816,917 L358F probably damaging Het
Slc45a1 A C 4: 150,643,305 I158M probably damaging Het
Slurp2 G A 15: 74,743,106 P62L probably damaging Het
Sspo C T 6: 48,466,740 H1949Y probably damaging Het
Tiam1 A T 16: 89,837,827 V865E possibly damaging Het
Tlr4 A C 4: 66,839,620 I217L probably damaging Het
Top1 C T 2: 160,712,708 R460* probably null Het
Trpm3 T A 19: 22,988,054 S1638T probably benign Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Vars T G 17: 35,012,727 probably null Het
Xylt2 A G 11: 94,666,333 Y111H probably benign Het
Zbed5 G A 5: 129,901,726 G172D probably damaging Het
Zfp53 C T 17: 21,508,833 T376I probably benign Het
Zfp937 G T 2: 150,239,546 V499L probably benign Het
Zyx T A 6: 42,351,313 L152Q probably damaging Het
Other mutations in Ints11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Ints11 APN 4 155885126 missense probably damaging 1.00
IGL01515:Ints11 APN 4 155875232 missense probably damaging 1.00
IGL01613:Ints11 APN 4 155885198 critical splice donor site probably null
IGL02024:Ints11 APN 4 155888515 missense probably damaging 1.00
IGL02127:Ints11 APN 4 155886863 missense probably damaging 1.00
IGL02850:Ints11 APN 4 155875304 missense probably benign 0.03
IGL02926:Ints11 APN 4 155888111 critical splice donor site probably null
IGL03296:Ints11 APN 4 155885323 critical splice donor site probably null
IGL03357:Ints11 APN 4 155872124 splice site probably benign
R0013:Ints11 UTSW 4 155887168 missense probably damaging 1.00
R0013:Ints11 UTSW 4 155887168 missense probably damaging 1.00
R0480:Ints11 UTSW 4 155887624 missense probably damaging 1.00
R0589:Ints11 UTSW 4 155886886 missense probably damaging 1.00
R0678:Ints11 UTSW 4 155887753 missense probably damaging 1.00
R0865:Ints11 UTSW 4 155887107 splice site probably null
R1135:Ints11 UTSW 4 155887927 splice site probably null
R1466:Ints11 UTSW 4 155888110 critical splice donor site probably null
R1466:Ints11 UTSW 4 155888110 critical splice donor site probably null
R1658:Ints11 UTSW 4 155887728 missense probably damaging 0.97
R1707:Ints11 UTSW 4 155875198 missense probably benign 0.21
R2199:Ints11 UTSW 4 155875281 missense probably benign 0.07
R2876:Ints11 UTSW 4 155887425 unclassified probably benign
R4567:Ints11 UTSW 4 155885675 missense probably damaging 1.00
R4900:Ints11 UTSW 4 155888430 missense probably benign 0.01
R4964:Ints11 UTSW 4 155886928 missense probably damaging 1.00
R4966:Ints11 UTSW 4 155886928 missense probably damaging 1.00
R5306:Ints11 UTSW 4 155875208 missense probably damaging 1.00
R5963:Ints11 UTSW 4 155872912 nonsense probably null
R6246:Ints11 UTSW 4 155888089 missense probably benign
R7285:Ints11 UTSW 4 155886111 missense probably damaging 1.00
R7365:Ints11 UTSW 4 155872230 splice site probably null
R7768:Ints11 UTSW 4 155886939 missense probably damaging 0.97
R7774:Ints11 UTSW 4 155885683 missense probably benign 0.00
R7999:Ints11 UTSW 4 155886956 missense probably benign 0.12
R8103:Ints11 UTSW 4 155888230 missense possibly damaging 0.93
R8785:Ints11 UTSW 4 155869708 missense probably benign 0.17
R8825:Ints11 UTSW 4 155885130 nonsense probably null
Z1088:Ints11 UTSW 4 155886970 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ATTGGTGCATGGCGAAGCCAAG -3'
(R):5'- GCAATACCCACCCTACCACTGTTTG -3'

Sequencing Primer
(F):5'- TTCCTGAGGCAGAAGATTGAGC -3'
(R):5'- ACCACTGTTTGTACACTTACACTG -3'
Posted On2013-05-23