Incidental Mutation 'R5145:Ptprb'
ID395089
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission 042729-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5145 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116343915 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1413 (T1413A)
Ref Sequence ENSEMBL: ENSMUSP00000151821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083152
Predicted Effect probably benign
Transcript: ENSMUST00000092167
AA Change: T1126A

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: T1126A

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218553
AA Change: T1413A

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 G A 15: 11,285,876 G724R probably damaging Het
Adgrg7 T A 16: 56,742,319 I552L probably benign Het
Ankrd11 A G 8: 122,891,204 probably benign Het
Col12a1 T C 9: 79,706,300 T88A probably benign Het
Col6a5 T G 9: 105,934,245 I692L unknown Het
Cry2 T C 2: 92,413,060 I479V probably benign Het
Ddx21 T C 10: 62,587,539 probably null Het
Efcab12 T A 6: 115,823,277 I262F probably damaging Het
Eif2ak2 T C 17: 78,876,204 D72G possibly damaging Het
Fry T C 5: 150,370,224 F461L probably damaging Het
Gm38706 G A 6: 130,483,768 noncoding transcript Het
Gm9772 C T 17: 22,007,126 C59Y probably damaging Het
Meig1 T C 2: 3,409,226 E79G probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mfsd2b T A 12: 4,865,908 probably benign Het
Nfatc2 A C 2: 168,590,067 I42S probably benign Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Npy6r C T 18: 44,276,619 T369I probably benign Het
Olfr1352 A G 10: 78,984,309 E173G probably benign Het
Ptprc A G 1: 138,089,566 S624P probably benign Het
Pum3 A G 19: 27,399,769 V441A probably damaging Het
Ranbp2 T A 10: 58,480,038 D2193E probably damaging Het
Rbl1 A T 2: 157,175,477 probably benign Het
Rnf167 T C 11: 70,650,080 probably benign Het
Sdr9c7 T C 10: 127,902,390 V179A probably damaging Het
Sema3c A G 5: 17,727,617 N706S possibly damaging Het
Stt3a T C 9: 36,735,466 Y617C probably damaging Het
Tdrd6 T A 17: 43,626,075 S1361C probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Tti1 G A 2: 158,008,512 A269V probably benign Het
Ugt2a1 A G 5: 87,486,027 probably null Het
Vmn2r10 T C 5: 108,995,895 T730A possibly damaging Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7181:Ptprb UTSW 10 116368766 missense probably damaging 1.00
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7315:Ptprb UTSW 10 116362379 missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7381:Ptprb UTSW 10 116341133 missense probably benign
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
R7495:Ptprb UTSW 10 116341448 missense probably benign 0.12
R7508:Ptprb UTSW 10 116353991 nonsense probably null
R7571:Ptprb UTSW 10 116339430 missense probably damaging 1.00
R7586:Ptprb UTSW 10 116343874 missense probably damaging 0.97
R7623:Ptprb UTSW 10 116369309 missense possibly damaging 0.63
R7694:Ptprb UTSW 10 116372948 missense probably damaging 1.00
R7744:Ptprb UTSW 10 116277484 missense probably benign 0.10
R7752:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7826:Ptprb UTSW 10 116283677 small deletion probably benign
RF041:Ptprb UTSW 10 116283677 small deletion probably benign
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGGTTGAATGTGTCCACCAAG -3'
(R):5'- ATACTGTGACACCTCCCTGG -3'

Sequencing Primer
(F):5'- CCACCAAGGTATTGATTCTGGG -3'
(R):5'- GGCAATCCCTTACTGTTTGGGC -3'
Posted On2016-06-21