Incidental Mutation 'R5145:Tha1'
ID395092
Institutional Source Beutler Lab
Gene Symbol Tha1
Ensembl Gene ENSMUSG00000017713
Gene Namethreonine aldolase 1
SynonymsGLY1, 1300017K07Rik
MMRRC Submission 042729-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5145 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location117867952-117873481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 117869676 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 241 (S241A)
Ref Sequence ENSEMBL: ENSMUSP00000033230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033230] [ENSMUST00000093905]
Predicted Effect probably damaging
Transcript: ENSMUST00000033230
AA Change: S241A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033230
Gene: ENSMUSG00000017713
AA Change: S241A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Beta_elim_lyase 42 334 4.6e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093905
SMART Domains Protein: ENSMUSP00000091432
Gene: ENSMUSG00000070330

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 190 9.7e-14 PFAM
Pfam:Claudin_2 16 192 1.3e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153989
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 G A 15: 11,285,876 G724R probably damaging Het
Adgrg7 T A 16: 56,742,319 I552L probably benign Het
Ankrd11 A G 8: 122,891,204 probably benign Het
Col12a1 T C 9: 79,706,300 T88A probably benign Het
Col6a5 T G 9: 105,934,245 I692L unknown Het
Cry2 T C 2: 92,413,060 I479V probably benign Het
Ddx21 T C 10: 62,587,539 probably null Het
Efcab12 T A 6: 115,823,277 I262F probably damaging Het
Eif2ak2 T C 17: 78,876,204 D72G possibly damaging Het
Fry T C 5: 150,370,224 F461L probably damaging Het
Gm38706 G A 6: 130,483,768 noncoding transcript Het
Gm9772 C T 17: 22,007,126 C59Y probably damaging Het
Meig1 T C 2: 3,409,226 E79G probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mfsd2b T A 12: 4,865,908 probably benign Het
Nfatc2 A C 2: 168,590,067 I42S probably benign Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Npy6r C T 18: 44,276,619 T369I probably benign Het
Olfr1352 A G 10: 78,984,309 E173G probably benign Het
Ptprb A G 10: 116,343,915 T1413A probably benign Het
Ptprc A G 1: 138,089,566 S624P probably benign Het
Pum3 A G 19: 27,399,769 V441A probably damaging Het
Ranbp2 T A 10: 58,480,038 D2193E probably damaging Het
Rbl1 A T 2: 157,175,477 probably benign Het
Rnf167 T C 11: 70,650,080 probably benign Het
Sdr9c7 T C 10: 127,902,390 V179A probably damaging Het
Sema3c A G 5: 17,727,617 N706S possibly damaging Het
Stt3a T C 9: 36,735,466 Y617C probably damaging Het
Tdrd6 T A 17: 43,626,075 S1361C probably damaging Het
Tti1 G A 2: 158,008,512 A269V probably benign Het
Ugt2a1 A G 5: 87,486,027 probably null Het
Vmn2r10 T C 5: 108,995,895 T730A possibly damaging Het
Other mutations in Tha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Tha1 APN 11 117871005 splice site probably benign
IGL01434:Tha1 APN 11 117868599 missense probably benign 0.31
IGL01658:Tha1 APN 11 117871612 missense probably damaging 1.00
R0437:Tha1 UTSW 11 117868575 missense probably benign 0.17
R0671:Tha1 UTSW 11 117873157 splice site probably benign
R1958:Tha1 UTSW 11 117869353 unclassified probably benign
R2127:Tha1 UTSW 11 117869774 missense probably damaging 0.98
R3416:Tha1 UTSW 11 117873200 missense possibly damaging 0.67
R4825:Tha1 UTSW 11 117869379 missense probably damaging 1.00
R5266:Tha1 UTSW 11 117869676 missense probably damaging 1.00
R5267:Tha1 UTSW 11 117869676 missense probably damaging 1.00
R5339:Tha1 UTSW 11 117871082 missense possibly damaging 0.87
R5858:Tha1 UTSW 11 117873384 missense unknown
R6820:Tha1 UTSW 11 117871678 missense probably benign 0.00
R7399:Tha1 UTSW 11 117869690 missense possibly damaging 0.86
R7706:Tha1 UTSW 11 117869455 missense probably damaging 1.00
R7905:Tha1 UTSW 11 117871067 missense possibly damaging 0.91
R7988:Tha1 UTSW 11 117871067 missense possibly damaging 0.91
R8094:Tha1 UTSW 11 117868497 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCTCTGGGCATTCTCGTGG -3'
(R):5'- AATTTTGCCTCTGAACACCACC -3'

Sequencing Primer
(F):5'- GCGCCATGCTTCTCCAATGAAG -3'
(R):5'- GAACACCACCTGCCCTTTG -3'
Posted On2016-06-21