Incidental Mutation 'R5145:Nlgn3'
ID395102
Institutional Source Beutler Lab
Gene Symbol Nlgn3
Ensembl Gene ENSMUSG00000031302
Gene Nameneuroligin 3
SynonymsNL3, A230085M13Rik, HNL3
MMRRC Submission 042729-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5145 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location101299168-101325963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101318285 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 287 (V287I)
Ref Sequence ENSEMBL: ENSMUSP00000113863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065858] [ENSMUST00000118111] [ENSMUST00000130555] [ENSMUST00000151528]
Predicted Effect probably benign
Transcript: ENSMUST00000065858
AA Change: V401I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000066304
Gene: ENSMUSG00000031302
AA Change: V401I

DomainStartEndE-ValueType
Pfam:COesterase 16 601 2.3e-194 PFAM
Pfam:Abhydrolase_3 180 342 1.7e-7 PFAM
transmembrane domain 685 707 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113671
Predicted Effect probably benign
Transcript: ENSMUST00000118111
AA Change: V287I

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113863
Gene: ENSMUSG00000031302
AA Change: V287I

DomainStartEndE-ValueType
Pfam:COesterase 3 487 3.6e-161 PFAM
Pfam:Abhydrolase_3 66 232 2.4e-7 PFAM
transmembrane domain 571 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130555
AA Change: V381I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122213
Gene: ENSMUSG00000031302
AA Change: V381I

DomainStartEndE-ValueType
Pfam:COesterase 16 510 4.6e-179 PFAM
Pfam:Abhydrolase_3 160 323 1.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144860
Predicted Effect probably benign
Transcript: ENSMUST00000151528
AA Change: V421I

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123283
Gene: ENSMUSG00000031302
AA Change: V421I

DomainStartEndE-ValueType
Pfam:COesterase 16 621 3.4e-207 PFAM
Pfam:Abhydrolase_3 200 363 1.2e-6 PFAM
transmembrane domain 705 727 N/A INTRINSIC
Meta Mutation Damage Score 0.0991 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. Mutations in this gene may be associated with autism and Asperger syndrome. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice show impaired context and cued conditioning, hyperactivity, altered social behavior, less vocalization, smaller brains, and impaired olfaction. Males carrying a knock-in allele show impaired social interaction, and enhanced spatial learning and inhibitory synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 G A 15: 11,285,876 G724R probably damaging Het
Adgrg7 T A 16: 56,742,319 I552L probably benign Het
Ankrd11 A G 8: 122,891,204 probably benign Het
Col12a1 T C 9: 79,706,300 T88A probably benign Het
Col6a5 T G 9: 105,934,245 I692L unknown Het
Cry2 T C 2: 92,413,060 I479V probably benign Het
Ddx21 T C 10: 62,587,539 probably null Het
Efcab12 T A 6: 115,823,277 I262F probably damaging Het
Eif2ak2 T C 17: 78,876,204 D72G possibly damaging Het
Fry T C 5: 150,370,224 F461L probably damaging Het
Gm38706 G A 6: 130,483,768 noncoding transcript Het
Gm9772 C T 17: 22,007,126 C59Y probably damaging Het
Meig1 T C 2: 3,409,226 E79G probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mfsd2b T A 12: 4,865,908 probably benign Het
Nfatc2 A C 2: 168,590,067 I42S probably benign Het
Npy6r C T 18: 44,276,619 T369I probably benign Het
Olfr1352 A G 10: 78,984,309 E173G probably benign Het
Ptprb A G 10: 116,343,915 T1413A probably benign Het
Ptprc A G 1: 138,089,566 S624P probably benign Het
Pum3 A G 19: 27,399,769 V441A probably damaging Het
Ranbp2 T A 10: 58,480,038 D2193E probably damaging Het
Rbl1 A T 2: 157,175,477 probably benign Het
Rnf167 T C 11: 70,650,080 probably benign Het
Sdr9c7 T C 10: 127,902,390 V179A probably damaging Het
Sema3c A G 5: 17,727,617 N706S possibly damaging Het
Stt3a T C 9: 36,735,466 Y617C probably damaging Het
Tdrd6 T A 17: 43,626,075 S1361C probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Tti1 G A 2: 158,008,512 A269V probably benign Het
Ugt2a1 A G 5: 87,486,027 probably null Het
Vmn2r10 T C 5: 108,995,895 T730A possibly damaging Het
Other mutations in Nlgn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Nlgn3 APN X 101320092 missense probably benign 0.28
IGL01327:Nlgn3 APN X 101318622 missense probably benign 0.08
IGL01414:Nlgn3 APN X 101302260 missense probably benign 0.00
R1296:Nlgn3 UTSW X 101308916 splice site probably benign
R1794:Nlgn3 UTSW X 101320033 missense probably benign 0.30
R5144:Nlgn3 UTSW X 101318285 missense probably benign 0.21
R5146:Nlgn3 UTSW X 101318285 missense probably benign 0.21
R8677:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
R8678:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
R8684:Nlgn3 UTSW X 101319819 nonsense probably null
R8696:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
Z1176:Nlgn3 UTSW X 101317982 missense probably benign 0.30
Z1176:Nlgn3 UTSW X 101319877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGACACTGTGGATATGGTG -3'
(R):5'- TCAGTGAAGAGTGCCACCAG -3'

Sequencing Primer
(F):5'- TGTCTTCGACAAAAGAGTGCC -3'
(R):5'- GAAGAGTGCCACCAGTGTTTTAC -3'
Posted On2016-06-21