Incidental Mutation 'R5146:Chil4'
ID395107
Institutional Source Beutler Lab
Gene Symbol Chil4
Ensembl Gene ENSMUSG00000063779
Gene Namechitinase-like 4
SynonymsYm2, Chi3l4
MMRRC Submission 042730-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5146 (G1)
Quality Score126
Status Validated
Chromosome3
Chromosomal Location106201490-106219507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106202834 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 315 (T315S)
Ref Sequence ENSEMBL: ENSMUSP00000080851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082219]
Predicted Effect probably benign
Transcript: ENSMUST00000082219
AA Change: T315S

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000080851
Gene: ENSMUSG00000063779
AA Change: T315S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 1.77e-132 SMART
Meta Mutation Damage Score 0.1402 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,243,025 D1498G possibly damaging Het
Adcyap1r1 A G 6: 55,484,972 I329V probably benign Het
Ahnak2 A C 12: 112,775,726 H637Q probably benign Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Cdh7 A G 1: 109,994,312 T45A probably damaging Het
Cntnap5c T C 17: 58,013,847 V138A probably damaging Het
Csmd1 T C 8: 16,196,190 D1065G probably damaging Het
Cspp1 C T 1: 10,074,876 R296* probably null Het
Dnah17 A G 11: 118,114,179 M793T probably damaging Het
Dock4 A G 12: 40,649,492 probably null Het
Fgfr4 G T 13: 55,165,912 L511F probably damaging Het
Gm14415 T C 2: 177,104,231 noncoding transcript Het
Gm7030 A G 17: 36,129,015 W76R probably damaging Het
Gpam A G 19: 55,093,946 V91A probably damaging Het
Grin2b T A 6: 135,779,342 I462F probably damaging Het
Grwd1 A T 7: 45,827,834 F210I probably damaging Het
Itfg1 T C 8: 85,718,868 *611W probably null Het
Kcna2 T C 3: 107,105,498 V465A probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Myo15b A G 11: 115,891,198 T1444A probably benign Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Oas1c A G 5: 120,802,094 S336P probably benign Het
Pirb T C 7: 3,712,621 probably benign Het
Pot1b A T 17: 55,672,865 Y330* probably null Het
Rnf20 A T 4: 49,651,456 M641L probably benign Het
Sppl2b T C 10: 80,867,640 *579Q probably null Het
Sumf1 G A 6: 108,185,310 P83S probably benign Het
Tmem101 C T 11: 102,154,624 R133Q probably benign Het
Ttn G A 2: 76,870,363 probably benign Het
Vmn2r84 A G 10: 130,386,102 Y750H probably damaging Het
Zfp873 A G 10: 82,060,224 Y300C probably damaging Het
Other mutations in Chil4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Chil4 APN 3 106201797 missense probably benign
IGL02457:Chil4 APN 3 106214399 missense probably benign
R1087:Chil4 UTSW 3 106210565 missense probably benign 0.01
R1398:Chil4 UTSW 3 106219509 splice site probably null
R1503:Chil4 UTSW 3 106206034 missense probably benign
R1553:Chil4 UTSW 3 106203690 missense probably benign 0.02
R1806:Chil4 UTSW 3 106210643 splice site probably benign
R1873:Chil4 UTSW 3 106206098 missense probably benign 0.00
R2069:Chil4 UTSW 3 106219455 missense probably benign 0.16
R2100:Chil4 UTSW 3 106214347 missense probably benign
R2370:Chil4 UTSW 3 106214300 nonsense probably null
R2984:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R2985:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R3522:Chil4 UTSW 3 106203740 missense probably benign 0.08
R3919:Chil4 UTSW 3 106202532 missense probably benign 0.00
R4033:Chil4 UTSW 3 106214449 missense probably damaging 1.00
R4181:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4184:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4301:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4347:Chil4 UTSW 3 106202828 missense probably benign
R4391:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4395:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4418:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4483:Chil4 UTSW 3 106214362 missense probably damaging 1.00
R4544:Chil4 UTSW 3 106210606 missense probably damaging 0.97
R4887:Chil4 UTSW 3 106204144 missense probably benign 0.01
R4949:Chil4 UTSW 3 106206092 missense possibly damaging 0.83
R5076:Chil4 UTSW 3 106202597 missense probably damaging 1.00
R5254:Chil4 UTSW 3 106219452 missense probably benign 0.00
R5521:Chil4 UTSW 3 106203697 missense possibly damaging 0.50
R5790:Chil4 UTSW 3 106202578 missense probably benign 0.00
R5883:Chil4 UTSW 3 106210570 missense possibly damaging 0.48
R6010:Chil4 UTSW 3 106214395 missense probably damaging 1.00
R6257:Chil4 UTSW 3 106204096 missense possibly damaging 0.84
R6269:Chil4 UTSW 3 106204171 missense probably damaging 1.00
R6602:Chil4 UTSW 3 106210590 missense probably benign 0.00
R7113:Chil4 UTSW 3 106202767 missense probably damaging 1.00
R7113:Chil4 UTSW 3 106214348 missense probably benign
R7188:Chil4 UTSW 3 106204159 missense probably damaging 1.00
R7980:Chil4 UTSW 3 106202744 missense probably damaging 1.00
R8810:Chil4 UTSW 3 106201805 missense probably damaging 0.99
X0067:Chil4 UTSW 3 106206034 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGAGCCACTGAGCCTGTTG -3'
(R):5'- GGGAAATGACTAGTTGTGCCCTG -3'

Sequencing Primer
(F):5'- GTTGAAACAGAGAGCATTTAGTCAC -3'
(R):5'- ACTAGTTGTGCCCTGTAGAACCAG -3'
Posted On2016-06-21