Mutagenetix > Incidental Mutation

Incidental Mutation 'R5146:Chil4'

395107

Institutional Source

Beutler Lab

Gene Symbol

Chil4

Ensembl Gene

ENSMUSG00000063779

Gene Name

chitinase-like 4

Synonyms

Ym2, Chi3l4

MMRRC Submission

042730-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5146 (G1)

Quality Score

126

Status

Validated

Chromosome

Chromosomal Location

106201490-106219507 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 106202834 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 315 (T315S)

Ref Sequence

ENSEMBL: ENSMUSP00000080851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082219]

AlphaFold

Q91Z98

Predicted Effect

probably benign
Transcript: ENSMUST00000082219
AA Change: T315S

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000080851
Gene: ENSMUSG00000063779
AA Change: T315S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Glyco_18	22	365	1.77e-132	SMART

Meta Mutation Damage Score

0.1402

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

97% (35/36)

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	A	G	12: 71,243,025	D1498G	possibly damaging	Het
Adcyap1r1	A	G	6: 55,484,972	I329V	probably benign	Het
Ahnak2	A	C	12: 112,775,726	H637Q	probably benign	Het
Carmil3	A	G	14: 55,497,179	D455G	probably benign	Het
Cdh7	A	G	1: 109,994,312	T45A	probably damaging	Het
Cntnap5c	T	C	17: 58,013,847	V138A	probably damaging	Het
Csmd1	T	C	8: 16,196,190	D1065G	probably damaging	Het
Cspp1	C	T	1: 10,074,876	R296*	probably null	Het
Dnah17	A	G	11: 118,114,179	M793T	probably damaging	Het
Dock4	A	G	12: 40,649,492		probably null	Het
Fgfr4	G	T	13: 55,165,912	L511F	probably damaging	Het
Gm14415	T	C	2: 177,104,231		noncoding transcript	Het
Gm7030	A	G	17: 36,129,015	W76R	probably damaging	Het
Gpam	A	G	19: 55,093,946	V91A	probably damaging	Het
Grin2b	T	A	6: 135,779,342	I462F	probably damaging	Het
Grwd1	A	T	7: 45,827,834	F210I	probably damaging	Het
Itfg1	T	C	8: 85,718,868	*611W	probably null	Het
Kcna2	T	C	3: 107,105,498	V465A	probably benign	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Myo15b	A	G	11: 115,891,198	T1444A	probably benign	Het
Nlgn3	G	A	X: 101,318,285	V287I	probably benign	Het
Oas1c	A	G	5: 120,802,094	S336P	probably benign	Het
Pirb	T	C	7: 3,712,621		probably benign	Het
Pot1b	A	T	17: 55,672,865	Y330*	probably null	Het
Rnf20	A	T	4: 49,651,456	M641L	probably benign	Het
Sppl2b	T	C	10: 80,867,640	*579Q	probably null	Het
Sumf1	G	A	6: 108,185,310	P83S	probably benign	Het
Tmem101	C	T	11: 102,154,624	R133Q	probably benign	Het
Ttn	G	A	2: 76,870,363		probably benign	Het
Vmn2r84	A	G	10: 130,386,102	Y750H	probably damaging	Het
Zfp873	A	G	10: 82,060,224	Y300C	probably damaging	Het

Other mutations in Chil4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Chil4	APN	3	106201797	missense	probably benign
IGL02457:Chil4	APN	3	106214399	missense	probably benign
R1087:Chil4	UTSW	3	106210565	missense	probably benign	0.01
R1398:Chil4	UTSW	3	106219509	splice site	probably null
R1503:Chil4	UTSW	3	106206034	missense	probably benign
R1553:Chil4	UTSW	3	106203690	missense	probably benign	0.02
R1806:Chil4	UTSW	3	106210643	splice site	probably benign
R1873:Chil4	UTSW	3	106206098	missense	probably benign	0.00
R2069:Chil4	UTSW	3	106219455	missense	probably benign	0.16
R2100:Chil4	UTSW	3	106214347	missense	probably benign
R2370:Chil4	UTSW	3	106214300	nonsense	probably null
R2984:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R2985:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R3522:Chil4	UTSW	3	106203740	missense	probably benign	0.08
R3919:Chil4	UTSW	3	106202532	missense	probably benign	0.00
R4033:Chil4	UTSW	3	106214449	missense	probably damaging	1.00
R4181:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4184:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4301:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4347:Chil4	UTSW	3	106202828	missense	probably benign
R4391:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4395:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4418:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4483:Chil4	UTSW	3	106214362	missense	probably damaging	1.00
R4544:Chil4	UTSW	3	106210606	missense	probably damaging	0.97
R4887:Chil4	UTSW	3	106204144	missense	probably benign	0.01
R4949:Chil4	UTSW	3	106206092	missense	possibly damaging	0.83
R5076:Chil4	UTSW	3	106202597	missense	probably damaging	1.00
R5254:Chil4	UTSW	3	106219452	missense	probably benign	0.00
R5521:Chil4	UTSW	3	106203697	missense	possibly damaging	0.50
R5790:Chil4	UTSW	3	106202578	missense	probably benign	0.00
R5883:Chil4	UTSW	3	106210570	missense	possibly damaging	0.48
R6010:Chil4	UTSW	3	106214395	missense	probably damaging	1.00
R6257:Chil4	UTSW	3	106204096	missense	possibly damaging	0.84
R6269:Chil4	UTSW	3	106204171	missense	probably damaging	1.00
R6602:Chil4	UTSW	3	106210590	missense	probably benign	0.00
R7113:Chil4	UTSW	3	106202767	missense	probably damaging	1.00
R7113:Chil4	UTSW	3	106214348	missense	probably benign
R7188:Chil4	UTSW	3	106204159	missense	probably damaging	1.00
R7980:Chil4	UTSW	3	106202744	missense	probably damaging	1.00
R8810:Chil4	UTSW	3	106201805	missense	probably damaging	0.99
R9300:Chil4	UTSW	3	106202558	missense	probably benign	0.10
R9307:Chil4	UTSW	3	106204066	critical splice donor site	probably null
R9529:Chil4	UTSW	3	106211340	missense	probably damaging	1.00
X0067:Chil4	UTSW	3	106206034	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTGAGCCACTGAGCCTGTTG -3'
(R):5'- GGGAAATGACTAGTTGTGCCCTG -3'

Sequencing Primer
(F):5'- GTTGAAACAGAGAGCATTTAGTCAC -3'
(R):5'- ACTAGTTGTGCCCTGTAGAACCAG -3'

Posted On

2016-06-21