Incidental Mutation 'R5146:Kcna2'
ID395108
Institutional Source Beutler Lab
Gene Symbol Kcna2
Ensembl Gene ENSMUSG00000040724
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 2
SynonymsMk-2, Akr6a4, Kca1-2, Kv1.2
MMRRC Submission 042730-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5146 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107101146-107115005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107105498 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 465 (V465A)
Ref Sequence ENSEMBL: ENSMUSP00000143798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038695] [ENSMUST00000196403] [ENSMUST00000197470]
Predicted Effect probably benign
Transcript: ENSMUST00000038695
AA Change: V465A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041702
Gene: ENSMUSG00000040724
AA Change: V465A

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196403
AA Change: V465A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142873
Gene: ENSMUSG00000040724
AA Change: V465A

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
low complexity region 164 179 N/A INTRINSIC
Pfam:Ion_trans 224 409 1.3e-36 PFAM
Pfam:Ion_trans_2 329 414 7.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197470
AA Change: V465A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143798
Gene: ENSMUSG00000040724
AA Change: V465A

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. The coding region of this gene is intronless, and the gene is clustered with genes KCNA3 and KCNA10 on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, increased susceptibility to spontaneous and chemically-induced seizures and altered neuron electrophysiology. Mice homozygous for an ENU-induced allele exhibit abnormal gait, impaired coordination, and premature lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,243,025 D1498G possibly damaging Het
Adcyap1r1 A G 6: 55,484,972 I329V probably benign Het
Ahnak2 A C 12: 112,775,726 H637Q probably benign Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Cdh7 A G 1: 109,994,312 T45A probably damaging Het
Chil4 T A 3: 106,202,834 T315S probably benign Het
Cntnap5c T C 17: 58,013,847 V138A probably damaging Het
Csmd1 T C 8: 16,196,190 D1065G probably damaging Het
Cspp1 C T 1: 10,074,876 R296* probably null Het
Dnah17 A G 11: 118,114,179 M793T probably damaging Het
Dock4 A G 12: 40,649,492 probably null Het
Fgfr4 G T 13: 55,165,912 L511F probably damaging Het
Gm14415 T C 2: 177,104,231 noncoding transcript Het
Gm7030 A G 17: 36,129,015 W76R probably damaging Het
Gpam A G 19: 55,093,946 V91A probably damaging Het
Grin2b T A 6: 135,779,342 I462F probably damaging Het
Grwd1 A T 7: 45,827,834 F210I probably damaging Het
Itfg1 T C 8: 85,718,868 *611W probably null Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Myo15b A G 11: 115,891,198 T1444A probably benign Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Oas1c A G 5: 120,802,094 S336P probably benign Het
Pirb T C 7: 3,712,621 probably benign Het
Pot1b A T 17: 55,672,865 Y330* probably null Het
Rnf20 A T 4: 49,651,456 M641L probably benign Het
Sppl2b T C 10: 80,867,640 *579Q probably null Het
Sumf1 G A 6: 108,185,310 P83S probably benign Het
Tmem101 C T 11: 102,154,624 R133Q probably benign Het
Ttn G A 2: 76,870,363 probably benign Het
Vmn2r84 A G 10: 130,386,102 Y750H probably damaging Het
Zfp873 A G 10: 82,060,224 Y300C probably damaging Het
Other mutations in Kcna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Kcna2 APN 3 107104630 missense probably damaging 1.00
IGL00711:Kcna2 APN 3 107104753 missense probably benign
IGL02380:Kcna2 APN 3 107104958 missense probably benign 0.00
grim UTSW 3 107105027 missense probably damaging 1.00
IGL03097:Kcna2 UTSW 3 107105399 missense probably benign 0.02
R0117:Kcna2 UTSW 3 107105354 missense probably damaging 1.00
R0200:Kcna2 UTSW 3 107105160 missense probably benign
R0463:Kcna2 UTSW 3 107105160 missense probably benign
R0472:Kcna2 UTSW 3 107105516 missense probably benign
R0662:Kcna2 UTSW 3 107105401 missense probably benign
R0746:Kcna2 UTSW 3 107105168 missense probably benign
R1838:Kcna2 UTSW 3 107104512 missense probably benign
R1847:Kcna2 UTSW 3 107105113 missense possibly damaging 0.54
R1912:Kcna2 UTSW 3 107105401 missense probably benign
R1966:Kcna2 UTSW 3 107104630 missense probably damaging 1.00
R1971:Kcna2 UTSW 3 107104824 missense probably damaging 1.00
R2419:Kcna2 UTSW 3 107104153 missense probably benign 0.21
R3796:Kcna2 UTSW 3 107105590 missense probably benign 0.37
R3830:Kcna2 UTSW 3 107104796 missense probably benign 0.04
R4273:Kcna2 UTSW 3 107105193 missense probably benign 0.00
R4570:Kcna2 UTSW 3 107104795 missense probably benign
R4662:Kcna2 UTSW 3 107105417 missense probably benign
R4756:Kcna2 UTSW 3 107105417 missense probably benign
R5054:Kcna2 UTSW 3 107104340 missense probably damaging 1.00
R5069:Kcna2 UTSW 3 107104637 missense probably damaging 1.00
R5070:Kcna2 UTSW 3 107104637 missense probably damaging 1.00
R5126:Kcna2 UTSW 3 107104234 missense probably damaging 1.00
R5205:Kcna2 UTSW 3 107097146 unclassified probably benign
R5472:Kcna2 UTSW 3 107105309 missense possibly damaging 0.93
R6687:Kcna2 UTSW 3 107105027 missense probably damaging 1.00
R6689:Kcna2 UTSW 3 107105027 missense probably damaging 1.00
R7216:Kcna2 UTSW 3 107104793 missense probably damaging 0.99
R7304:Kcna2 UTSW 3 107104750 missense probably benign
R7538:Kcna2 UTSW 3 107104568 missense probably benign 0.31
R7585:Kcna2 UTSW 3 107105342 missense probably damaging 1.00
R7968:Kcna2 UTSW 3 107105144 missense possibly damaging 0.79
R8241:Kcna2 UTSW 3 107105022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCAGTCCCTGTCATAGTGTC -3'
(R):5'- CCATGCAGAACCAGATGCTG -3'

Sequencing Primer
(F):5'- AGTCCCTGTCATAGTGTCTAATTTC -3'
(R):5'- TGCTGTAGAACACTGTAGAACACTG -3'
Posted On2016-06-21