Incidental Mutation 'R5146:Oas1c'
ID395110
Institutional Source Beutler Lab
Gene Symbol Oas1c
Ensembl Gene ENSMUSG00000001166
Gene Name2'-5' oligoadenylate synthetase 1C
SynonymsOasl5
MMRRC Submission 042730-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5146 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120800194-120812514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120802094 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 336 (S336P)
Ref Sequence ENSEMBL: ENSMUSP00000112584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117193] [ENSMUST00000125547]
Predicted Effect probably benign
Transcript: ENSMUST00000117193
AA Change: S336P

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112584
Gene: ENSMUSG00000001166
AA Change: S336P

DomainStartEndE-ValueType
Pfam:OAS1_C 168 354 1.4e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130045
SMART Domains Protein: ENSMUSP00000122510
Gene: ENSMUSG00000001166

DomainStartEndE-ValueType
Pfam:OAS1_C 89 146 3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201006
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,243,025 D1498G possibly damaging Het
Adcyap1r1 A G 6: 55,484,972 I329V probably benign Het
Ahnak2 A C 12: 112,775,726 H637Q probably benign Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Cdh7 A G 1: 109,994,312 T45A probably damaging Het
Chil4 T A 3: 106,202,834 T315S probably benign Het
Cntnap5c T C 17: 58,013,847 V138A probably damaging Het
Csmd1 T C 8: 16,196,190 D1065G probably damaging Het
Cspp1 C T 1: 10,074,876 R296* probably null Het
Dnah17 A G 11: 118,114,179 M793T probably damaging Het
Dock4 A G 12: 40,649,492 probably null Het
Fgfr4 G T 13: 55,165,912 L511F probably damaging Het
Gm14415 T C 2: 177,104,231 noncoding transcript Het
Gm7030 A G 17: 36,129,015 W76R probably damaging Het
Gpam A G 19: 55,093,946 V91A probably damaging Het
Grin2b T A 6: 135,779,342 I462F probably damaging Het
Grwd1 A T 7: 45,827,834 F210I probably damaging Het
Itfg1 T C 8: 85,718,868 *611W probably null Het
Kcna2 T C 3: 107,105,498 V465A probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Myo15b A G 11: 115,891,198 T1444A probably benign Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Pirb T C 7: 3,712,621 probably benign Het
Pot1b A T 17: 55,672,865 Y330* probably null Het
Rnf20 A T 4: 49,651,456 M641L probably benign Het
Sppl2b T C 10: 80,867,640 *579Q probably null Het
Sumf1 G A 6: 108,185,310 P83S probably benign Het
Tmem101 C T 11: 102,154,624 R133Q probably benign Het
Ttn G A 2: 76,870,363 probably benign Het
Vmn2r84 A G 10: 130,386,102 Y750H probably damaging Het
Zfp873 A G 10: 82,060,224 Y300C probably damaging Het
Other mutations in Oas1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Oas1c APN 5 120808679 missense probably benign 0.00
IGL01472:Oas1c APN 5 120802921 missense probably damaging 1.00
IGL01931:Oas1c APN 5 120805495 missense probably benign 0.20
IGL02429:Oas1c APN 5 120802068 missense probably benign 0.30
IGL02498:Oas1c APN 5 120805526 missense possibly damaging 0.83
IGL02696:Oas1c APN 5 120805463 missense probably benign 0.44
IGL02957:Oas1c APN 5 120805413 nonsense probably null
sandshrew UTSW 5 120808139 missense probably damaging 0.99
R0562:Oas1c UTSW 5 120805604 splice site probably benign
R1819:Oas1c UTSW 5 120808735 missense possibly damaging 0.89
R1853:Oas1c UTSW 5 120807995 missense probably damaging 1.00
R1937:Oas1c UTSW 5 120802984 missense probably benign 0.00
R2248:Oas1c UTSW 5 120802861 missense possibly damaging 0.48
R2258:Oas1c UTSW 5 120803017 missense probably null 1.00
R2570:Oas1c UTSW 5 120805438 missense probably benign 0.05
R3965:Oas1c UTSW 5 120808718 missense probably damaging 1.00
R4164:Oas1c UTSW 5 120808139 missense probably damaging 0.99
R5875:Oas1c UTSW 5 120805562 missense probably damaging 1.00
R5938:Oas1c UTSW 5 120805533 missense probably benign 0.05
R7219:Oas1c UTSW 5 120802892 missense probably damaging 1.00
R7443:Oas1c UTSW 5 120805419 missense probably damaging 1.00
R7451:Oas1c UTSW 5 120802142 missense possibly damaging 0.57
R7578:Oas1c UTSW 5 120802179 missense probably damaging 1.00
R7788:Oas1c UTSW 5 120801042 missense probably benign
R8891:Oas1c UTSW 5 120808061 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCTCAGTTCTGAATCTCC -3'
(R):5'- AGCTTTGGATAGGGATGCAG -3'

Sequencing Primer
(F):5'- TCAAAGCCAGGTCTTCAGTG -3'
(R):5'- ATGCAGTGCTGGGCTCCTC -3'
Posted On2016-06-21