Incidental Mutation 'R5146:Adcyap1r1'
ID395111
Institutional Source Beutler Lab
Gene Symbol Adcyap1r1
Ensembl Gene ENSMUSG00000029778
Gene Nameadenylate cyclase activating polypeptide 1 receptor 1
SynonymsPAC1R, PAC1, PACAP1-R, 2900024I10Rik
MMRRC Submission 042730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R5146 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location55451978-55501451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55484972 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 329 (I329V)
Ref Sequence ENSEMBL: ENSMUSP00000130923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070736] [ENSMUST00000070756] [ENSMUST00000165786] [ENSMUST00000165857] [ENSMUST00000167234] [ENSMUST00000172084]
Predicted Effect probably benign
Transcript: ENSMUST00000070736
AA Change: I329V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063784
Gene: ENSMUSG00000029778
AA Change: I329V

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 424 3.6e-92 PFAM
low complexity region 474 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070756
AA Change: I329V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066902
Gene: ENSMUSG00000029778
AA Change: I329V

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 396 2.6e-93 PFAM
low complexity region 446 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165786
AA Change: I329V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130923
Gene: ENSMUSG00000029778
AA Change: I329V

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 423 2.6e-92 PFAM
low complexity region 473 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165857
AA Change: I329V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129614
Gene: ENSMUSG00000029778
AA Change: I329V

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 424 1.4e-94 PFAM
low complexity region 474 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167234
AA Change: I329V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126994
Gene: ENSMUSG00000029778
AA Change: I329V

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 452 1.4e-91 PFAM
low complexity region 502 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172084
AA Change: I308V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127319
Gene: ENSMUSG00000029778
AA Change: I308V

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 122 2.15e-27 SMART
Pfam:7tm_2 129 375 9e-94 PFAM
low complexity region 425 440 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes type I adenylate cyclase activating polypeptide receptor, which is a membrane-associated protein and shares significant homology with members of the glucagon/secretin receptor family. This receptor mediates diverse biological actions of adenylate cyclase activating polypeptide 1 and is positively coupled to adenylate cyclase. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygotes for targeted mutations affect contextual fear conditioning, elevated locomotor activity, anxiety-like behavior, susceptibility to endotoxic shock, circadian responses to a photic stimulus, and glucose tolerance. Some alleles affect female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,243,025 D1498G possibly damaging Het
Ahnak2 A C 12: 112,775,726 H637Q probably benign Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Cdh7 A G 1: 109,994,312 T45A probably damaging Het
Chil4 T A 3: 106,202,834 T315S probably benign Het
Cntnap5c T C 17: 58,013,847 V138A probably damaging Het
Csmd1 T C 8: 16,196,190 D1065G probably damaging Het
Cspp1 C T 1: 10,074,876 R296* probably null Het
Dnah17 A G 11: 118,114,179 M793T probably damaging Het
Dock4 A G 12: 40,649,492 probably null Het
Fgfr4 G T 13: 55,165,912 L511F probably damaging Het
Gm14415 T C 2: 177,104,231 noncoding transcript Het
Gm7030 A G 17: 36,129,015 W76R probably damaging Het
Gpam A G 19: 55,093,946 V91A probably damaging Het
Grin2b T A 6: 135,779,342 I462F probably damaging Het
Grwd1 A T 7: 45,827,834 F210I probably damaging Het
Itfg1 T C 8: 85,718,868 *611W probably null Het
Kcna2 T C 3: 107,105,498 V465A probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Myo15b A G 11: 115,891,198 T1444A probably benign Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Oas1c A G 5: 120,802,094 S336P probably benign Het
Pirb T C 7: 3,712,621 probably benign Het
Pot1b A T 17: 55,672,865 Y330* probably null Het
Rnf20 A T 4: 49,651,456 M641L probably benign Het
Sppl2b T C 10: 80,867,640 *579Q probably null Het
Sumf1 G A 6: 108,185,310 P83S probably benign Het
Tmem101 C T 11: 102,154,624 R133Q probably benign Het
Ttn G A 2: 76,870,363 probably benign Het
Vmn2r84 A G 10: 130,386,102 Y750H probably damaging Het
Zfp873 A G 10: 82,060,224 Y300C probably damaging Het
Other mutations in Adcyap1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Adcyap1r1 APN 6 55472279 missense probably damaging 1.00
IGL00837:Adcyap1r1 APN 6 55461620 splice site probably benign
IGL02686:Adcyap1r1 APN 6 55481125 missense probably benign 0.37
IGL03229:Adcyap1r1 APN 6 55478123 missense probably damaging 1.00
PIT4458001:Adcyap1r1 UTSW 6 55478082 missense probably benign 0.00
R0360:Adcyap1r1 UTSW 6 55475523 intron probably benign
R0517:Adcyap1r1 UTSW 6 55491297 missense probably damaging 0.99
R1169:Adcyap1r1 UTSW 6 55494116 missense probably damaging 1.00
R1897:Adcyap1r1 UTSW 6 55479194 missense probably damaging 1.00
R2113:Adcyap1r1 UTSW 6 55481115 missense probably damaging 0.99
R4462:Adcyap1r1 UTSW 6 55480099 missense possibly damaging 0.90
R4871:Adcyap1r1 UTSW 6 55480093 missense probably null 0.34
R5341:Adcyap1r1 UTSW 6 55478069 missense probably benign 0.00
R6426:Adcyap1r1 UTSW 6 55494187 missense probably damaging 1.00
R6599:Adcyap1r1 UTSW 6 55479994 missense probably damaging 1.00
R6928:Adcyap1r1 UTSW 6 55479272 missense possibly damaging 0.92
R7059:Adcyap1r1 UTSW 6 55491310 missense probably damaging 0.98
R8383:Adcyap1r1 UTSW 6 55480000 missense probably damaging 1.00
R8784:Adcyap1r1 UTSW 6 55481115 missense probably damaging 0.99
R8882:Adcyap1r1 UTSW 6 55491234 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGCTTCAGAAAGTGCTCGC -3'
(R):5'- ATTGCCCATGCTAGGTCAAC -3'

Sequencing Primer
(F):5'- AGAAAGTGCTCGCCCCCTG -3'
(R):5'- GGTCAACCTGCCAGCAAAGTTC -3'
Posted On2016-06-21