Mutagenetix > Incidental Mutations

Incidental Mutation 'R5146:Adcyap1r1'

395111

Institutional Source

Beutler Lab

Gene Symbol

Adcyap1r1

Ensembl Gene

ENSMUSG00000029778

Gene Name

adenylate cyclase activating polypeptide 1 receptor 1

Synonyms

PAC1R, PAC1, PACAP1-R, 2900024I10Rik

MMRRC Submission

042730-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.240) question?

Stock #

R5146 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55451978-55501451 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55484972 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 329 (I329V)

Ref Sequence

ENSEMBL: ENSMUSP00000130923 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070736] [ENSMUST00000070756] [ENSMUST00000165786] [ENSMUST00000165857] [ENSMUST00000167234] [ENSMUST00000172084]

Predicted Effect

probably benign
Transcript: ENSMUST00000070736
AA Change: I329V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000063784
Gene: ENSMUSG00000029778
AA Change: I329V

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
HormR	50	143	7.2e-29	SMART
Pfam:7tm_2	150	424	3.6e-92	PFAM
low complexity region	474	489	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000070756
AA Change: I329V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000066902
Gene: ENSMUSG00000029778
AA Change: I329V

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
HormR	50	143	7.2e-29	SMART
Pfam:7tm_2	150	396	2.6e-93	PFAM
low complexity region	446	461	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165786
AA Change: I329V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000130923
Gene: ENSMUSG00000029778
AA Change: I329V

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
HormR	50	143	7.2e-29	SMART
Pfam:7tm_2	150	423	2.6e-92	PFAM
low complexity region	473	488	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165857
AA Change: I329V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129614
Gene: ENSMUSG00000029778
AA Change: I329V

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
HormR	50	143	7.2e-29	SMART
Pfam:7tm_2	150	424	1.4e-94	PFAM
low complexity region	474	489	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167234
AA Change: I329V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126994
Gene: ENSMUSG00000029778
AA Change: I329V

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
HormR	50	143	7.2e-29	SMART
Pfam:7tm_2	150	452	1.4e-91	PFAM
low complexity region	502	517	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172084
AA Change: I308V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000127319
Gene: ENSMUSG00000029778
AA Change: I308V

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
HormR	50	122	2.15e-27	SMART
Pfam:7tm_2	129	375	9e-94	PFAM
low complexity region	425	440	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes type I adenylate cyclase activating polypeptide receptor, which is a membrane-associated protein and shares significant homology with members of the glucagon/secretin receptor family. This receptor mediates diverse biological actions of adenylate cyclase activating polypeptide 1 and is positively coupled to adenylate cyclase. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygotes for targeted mutations affect contextual fear conditioning, elevated locomotor activity, anxiety-like behavior, susceptibility to endotoxic shock, circadian responses to a photic stimulus, and glucose tolerance. Some alleles affect female fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	A	G	12: 71,243,025	D1498G	possibly damaging	Het
Ahnak2	A	C	12: 112,775,726	H637Q	probably benign	Het
Carmil3	A	G	14: 55,497,179	D455G	probably benign	Het
Cdh7	A	G	1: 109,994,312	T45A	probably damaging	Het
Chil4	T	A	3: 106,202,834	T315S	probably benign	Het
Cntnap5c	T	C	17: 58,013,847	V138A	probably damaging	Het
Csmd1	T	C	8: 16,196,190	D1065G	probably damaging	Het
Cspp1	C	T	1: 10,074,876	R296*	probably null	Het
Dnah17	A	G	11: 118,114,179	M793T	probably damaging	Het
Dock4	A	G	12: 40,649,492		probably null	Het
Fgfr4	G	T	13: 55,165,912	L511F	probably damaging	Het
Gm14415	T	C	2: 177,104,231		noncoding transcript	Het
Gm7030	A	G	17: 36,129,015	W76R	probably damaging	Het
Gpam	A	G	19: 55,093,946	V91A	probably damaging	Het
Grin2b	T	A	6: 135,779,342	I462F	probably damaging	Het
Grwd1	A	T	7: 45,827,834	F210I	probably damaging	Het
Itfg1	T	C	8: 85,718,868	*611W	probably null	Het
Kcna2	T	C	3: 107,105,498	V465A	probably benign	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Myo15b	A	G	11: 115,891,198	T1444A	probably benign	Het
Nlgn3	G	A	X: 101,318,285	V287I	probably benign	Het
Oas1c	A	G	5: 120,802,094	S336P	probably benign	Het
Pirb	T	C	7: 3,712,621		probably benign	Het
Pot1b	A	T	17: 55,672,865	Y330*	probably null	Het
Rnf20	A	T	4: 49,651,456	M641L	probably benign	Het
Sppl2b	T	C	10: 80,867,640	*579Q	probably null	Het
Sumf1	G	A	6: 108,185,310	P83S	probably benign	Het
Tmem101	C	T	11: 102,154,624	R133Q	probably benign	Het
Ttn	G	A	2: 76,870,363		probably benign	Het
Vmn2r84	A	G	10: 130,386,102	Y750H	probably damaging	Het
Zfp873	A	G	10: 82,060,224	Y300C	probably damaging	Het

Other mutations in Adcyap1r1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Adcyap1r1	APN	6	55472279	missense	probably damaging	1.00
IGL00837:Adcyap1r1	APN	6	55461620	splice site	probably benign
IGL02686:Adcyap1r1	APN	6	55481125	missense	probably benign	0.37
IGL03229:Adcyap1r1	APN	6	55478123	missense	probably damaging	1.00
PIT4458001:Adcyap1r1	UTSW	6	55478082	missense	probably benign	0.00
R0360:Adcyap1r1	UTSW	6	55475523	intron	probably benign
R0517:Adcyap1r1	UTSW	6	55491297	missense	probably damaging	0.99
R1169:Adcyap1r1	UTSW	6	55494116	missense	probably damaging	1.00
R1897:Adcyap1r1	UTSW	6	55479194	missense	probably damaging	1.00
R2113:Adcyap1r1	UTSW	6	55481115	missense	probably damaging	0.99
R4462:Adcyap1r1	UTSW	6	55480099	missense	possibly damaging	0.90
R4871:Adcyap1r1	UTSW	6	55480093	missense	probably null	0.34
R5341:Adcyap1r1	UTSW	6	55478069	missense	probably benign	0.00
R6426:Adcyap1r1	UTSW	6	55494187	missense	probably damaging	1.00
R6599:Adcyap1r1	UTSW	6	55479994	missense	probably damaging	1.00
R6928:Adcyap1r1	UTSW	6	55479272	missense	possibly damaging	0.92
R7059:Adcyap1r1	UTSW	6	55491310	missense	probably damaging	0.98
R8383:Adcyap1r1	UTSW	6	55480000	missense	probably damaging	1.00
R8784:Adcyap1r1	UTSW	6	55481115	missense	probably damaging	0.99
R8882:Adcyap1r1	UTSW	6	55491234	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- TGCTTCAGAAAGTGCTCGC -3'
(R):5'- ATTGCCCATGCTAGGTCAAC -3'

Sequencing Primer
(F):5'- AGAAAGTGCTCGCCCCCTG -3'
(R):5'- GGTCAACCTGCCAGCAAAGTTC -3'

Posted On

2016-06-21