Incidental Mutation 'R5146:Pirb'
ID395113
Institutional Source Beutler Lab
Gene Symbol Pirb
Ensembl Gene ENSMUSG00000058818
Gene Namepaired Ig-like receptor B
SynonymsLilrb3, Gp91
MMRRC Submission 042730-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5146 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location3711409-3720391 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 3712621 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078451]
Predicted Effect probably benign
Transcript: ENSMUST00000078451
SMART Domains Protein: ENSMUSP00000077546
Gene: ENSMUSG00000058818

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 34 118 1.8e-3 SMART
IG 129 315 1.2e-4 SMART
IG_like 237 302 6.2e-4 SMART
IG_like 328 415 3.4e-2 SMART
IG_like 435 502 1e-2 SMART
IG 529 618 3.6e-5 SMART
low complexity region 624 637 N/A INTRINSIC
transmembrane domain 641 663 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155131
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (35/36)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene display abnormalities in both B and T lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,243,025 D1498G possibly damaging Het
Adcyap1r1 A G 6: 55,484,972 I329V probably benign Het
Ahnak2 A C 12: 112,775,726 H637Q probably benign Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Cdh7 A G 1: 109,994,312 T45A probably damaging Het
Chil4 T A 3: 106,202,834 T315S probably benign Het
Cntnap5c T C 17: 58,013,847 V138A probably damaging Het
Csmd1 T C 8: 16,196,190 D1065G probably damaging Het
Cspp1 C T 1: 10,074,876 R296* probably null Het
Dnah17 A G 11: 118,114,179 M793T probably damaging Het
Dock4 A G 12: 40,649,492 probably null Het
Fgfr4 G T 13: 55,165,912 L511F probably damaging Het
Gm14415 T C 2: 177,104,231 noncoding transcript Het
Gm7030 A G 17: 36,129,015 W76R probably damaging Het
Gpam A G 19: 55,093,946 V91A probably damaging Het
Grin2b T A 6: 135,779,342 I462F probably damaging Het
Grwd1 A T 7: 45,827,834 F210I probably damaging Het
Itfg1 T C 8: 85,718,868 *611W probably null Het
Kcna2 T C 3: 107,105,498 V465A probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Myo15b A G 11: 115,891,198 T1444A probably benign Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Oas1c A G 5: 120,802,094 S336P probably benign Het
Pot1b A T 17: 55,672,865 Y330* probably null Het
Rnf20 A T 4: 49,651,456 M641L probably benign Het
Sppl2b T C 10: 80,867,640 *579Q probably null Het
Sumf1 G A 6: 108,185,310 P83S probably benign Het
Tmem101 C T 11: 102,154,624 R133Q probably benign Het
Ttn G A 2: 76,870,363 probably benign Het
Vmn2r84 A G 10: 130,386,102 Y750H probably damaging Het
Zfp873 A G 10: 82,060,224 Y300C probably damaging Het
Other mutations in Pirb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pirb APN 7 3717406 missense probably damaging 0.99
IGL01744:Pirb APN 7 3717176 nonsense probably null
IGL01755:Pirb APN 7 3717170 missense probably benign 0.16
IGL02580:Pirb APN 7 3714206 splice site probably null
IGL02941:Pirb APN 7 3717378 missense probably damaging 1.00
R0394:Pirb UTSW 7 3719248 missense probably benign 0.08
R0680:Pirb UTSW 7 3717361 missense possibly damaging 0.94
R0787:Pirb UTSW 7 3717638 missense probably benign
R0790:Pirb UTSW 7 3717638 missense probably benign
R0832:Pirb UTSW 7 3717638 missense probably benign
R1124:Pirb UTSW 7 3719732 missense probably benign 0.02
R1178:Pirb UTSW 7 3717638 missense probably benign
R1180:Pirb UTSW 7 3717638 missense probably benign
R1181:Pirb UTSW 7 3717638 missense probably benign
R1281:Pirb UTSW 7 3717190 missense probably damaging 1.00
R1343:Pirb UTSW 7 3717638 missense probably benign
R1579:Pirb UTSW 7 3717638 missense probably benign
R1699:Pirb UTSW 7 3717638 missense probably benign
R1768:Pirb UTSW 7 3717190 missense probably damaging 1.00
R1909:Pirb UTSW 7 3714588 missense probably benign 0.33
R1965:Pirb UTSW 7 3717638 missense probably benign
R1966:Pirb UTSW 7 3717638 missense probably benign
R2004:Pirb UTSW 7 3717638 missense probably benign
R2305:Pirb UTSW 7 3712991 missense probably benign 0.00
R2931:Pirb UTSW 7 3717206 missense probably benign 0.08
R3858:Pirb UTSW 7 3717663 missense possibly damaging 0.54
R3928:Pirb UTSW 7 3717638 missense probably benign
R3938:Pirb UTSW 7 3717638 missense probably benign
R4119:Pirb UTSW 7 3717575 missense probably damaging 1.00
R4174:Pirb UTSW 7 3716032 critical splice donor site probably null
R4248:Pirb UTSW 7 3719298 missense probably damaging 1.00
R4827:Pirb UTSW 7 3717603 missense probably benign
R4828:Pirb UTSW 7 3717603 missense probably benign
R4829:Pirb UTSW 7 3717603 missense probably benign
R4830:Pirb UTSW 7 3717603 missense probably benign
R4870:Pirb UTSW 7 3712662 missense probably benign 0.00
R4909:Pirb UTSW 7 3719362 nonsense probably null
R5244:Pirb UTSW 7 3716063 missense probably benign 0.32
R5323:Pirb UTSW 7 3716599 missense possibly damaging 0.85
R5921:Pirb UTSW 7 3716694 nonsense probably null
R6316:Pirb UTSW 7 3717823 missense probably damaging 1.00
R6502:Pirb UTSW 7 3717393 missense probably benign 0.00
R6811:Pirb UTSW 7 3719642 missense possibly damaging 0.91
R7216:Pirb UTSW 7 3716274 missense probably benign 0.00
R7275:Pirb UTSW 7 3716178 missense probably benign 0.00
R7327:Pirb UTSW 7 3717188 nonsense probably null
R7582:Pirb UTSW 7 3713818 critical splice donor site probably null
R7717:Pirb UTSW 7 3717783 missense not run
R7717:Pirb UTSW 7 3717801 missense not run
R7807:Pirb UTSW 7 3719865 missense possibly damaging 0.55
R7844:Pirb UTSW 7 3719411 nonsense probably null
R7927:Pirb UTSW 7 3719411 nonsense probably null
X0025:Pirb UTSW 7 3717268 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATGAGCTCAAAAGTTCTAAGTCC -3'
(R):5'- ATGTGACCTATGCCCAGCTG -3'

Sequencing Primer
(F):5'- GGCATGCAATTCCAAGCTTG -3'
(R):5'- TGTGCAGCAGGACACTCAGAC -3'
Posted On2016-06-21