Mutagenetix > Incidental Mutations

Incidental Mutation 'R5146:Pirb'

395113

Institutional Source

Beutler Lab

Gene Symbol

Pirb

Ensembl Gene

ENSMUSG00000058818

Gene Name

paired Ig-like receptor B

Synonyms

Lilrb3, Gp91

MMRRC Submission

042730-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5146 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3711409-3720391 bp(-) (GRCm38)

Type of Mutation

utr 3 prime

DNA Base Change (assembly)

T to C at 3712621 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000077546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078451]

Predicted Effect

probably benign
Transcript: ENSMUST00000078451

SMART Domains

Protein: ENSMUSP00000077546
Gene: ENSMUSG00000058818

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	34	118	1.8e-3	SMART
IG	129	315	1.2e-4	SMART
IG_like	237	302	6.2e-4	SMART
IG_like	328	415	3.4e-2	SMART
IG_like	435	502	1e-2	SMART
IG	529	618	3.6e-5	SMART
low complexity region	624	637	N/A	INTRINSIC
transmembrane domain	641	663	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129493

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136238

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137474

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155131

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

97% (35/36)

MGI Phenotype

PHENOTYPE: Mice homozygous for disruptions of this gene display abnormalities in both B and T lymphocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	A	G	12: 71,243,025	D1498G	possibly damaging	Het
Adcyap1r1	A	G	6: 55,484,972	I329V	probably benign	Het
Ahnak2	A	C	12: 112,775,726	H637Q	probably benign	Het
Carmil3	A	G	14: 55,497,179	D455G	probably benign	Het
Cdh7	A	G	1: 109,994,312	T45A	probably damaging	Het
Chil4	T	A	3: 106,202,834	T315S	probably benign	Het
Cntnap5c	T	C	17: 58,013,847	V138A	probably damaging	Het
Csmd1	T	C	8: 16,196,190	D1065G	probably damaging	Het
Cspp1	C	T	1: 10,074,876	R296*	probably null	Het
Dnah17	A	G	11: 118,114,179	M793T	probably damaging	Het
Dock4	A	G	12: 40,649,492		probably null	Het
Fgfr4	G	T	13: 55,165,912	L511F	probably damaging	Het
Gm14415	T	C	2: 177,104,231		noncoding transcript	Het
Gm7030	A	G	17: 36,129,015	W76R	probably damaging	Het
Gpam	A	G	19: 55,093,946	V91A	probably damaging	Het
Grin2b	T	A	6: 135,779,342	I462F	probably damaging	Het
Grwd1	A	T	7: 45,827,834	F210I	probably damaging	Het
Itfg1	T	C	8: 85,718,868	*611W	probably null	Het
Kcna2	T	C	3: 107,105,498	V465A	probably benign	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Myo15b	A	G	11: 115,891,198	T1444A	probably benign	Het
Nlgn3	G	A	X: 101,318,285	V287I	probably benign	Het
Oas1c	A	G	5: 120,802,094	S336P	probably benign	Het
Pot1b	A	T	17: 55,672,865	Y330*	probably null	Het
Rnf20	A	T	4: 49,651,456	M641L	probably benign	Het
Sppl2b	T	C	10: 80,867,640	*579Q	probably null	Het
Sumf1	G	A	6: 108,185,310	P83S	probably benign	Het
Tmem101	C	T	11: 102,154,624	R133Q	probably benign	Het
Ttn	G	A	2: 76,870,363		probably benign	Het
Vmn2r84	A	G	10: 130,386,102	Y750H	probably damaging	Het
Zfp873	A	G	10: 82,060,224	Y300C	probably damaging	Het

Other mutations in Pirb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Pirb	APN	7	3717406	missense	probably damaging	0.99
IGL01744:Pirb	APN	7	3717176	nonsense	probably null
IGL01755:Pirb	APN	7	3717170	missense	probably benign	0.16
IGL02580:Pirb	APN	7	3714206	splice site	probably null
IGL02941:Pirb	APN	7	3717378	missense	probably damaging	1.00
R0394:Pirb	UTSW	7	3719248	missense	probably benign	0.08
R0680:Pirb	UTSW	7	3717361	missense	possibly damaging	0.94
R0787:Pirb	UTSW	7	3717638	missense	probably benign
R0790:Pirb	UTSW	7	3717638	missense	probably benign
R0832:Pirb	UTSW	7	3717638	missense	probably benign
R1124:Pirb	UTSW	7	3719732	missense	probably benign	0.02
R1178:Pirb	UTSW	7	3717638	missense	probably benign
R1180:Pirb	UTSW	7	3717638	missense	probably benign
R1181:Pirb	UTSW	7	3717638	missense	probably benign
R1281:Pirb	UTSW	7	3717190	missense	probably damaging	1.00
R1343:Pirb	UTSW	7	3717638	missense	probably benign
R1579:Pirb	UTSW	7	3717638	missense	probably benign
R1699:Pirb	UTSW	7	3717638	missense	probably benign
R1768:Pirb	UTSW	7	3717190	missense	probably damaging	1.00
R1909:Pirb	UTSW	7	3714588	missense	probably benign	0.33
R1965:Pirb	UTSW	7	3717638	missense	probably benign
R1966:Pirb	UTSW	7	3717638	missense	probably benign
R2004:Pirb	UTSW	7	3717638	missense	probably benign
R2305:Pirb	UTSW	7	3712991	missense	probably benign	0.00
R2931:Pirb	UTSW	7	3717206	missense	probably benign	0.08
R3858:Pirb	UTSW	7	3717663	missense	possibly damaging	0.54
R3928:Pirb	UTSW	7	3717638	missense	probably benign
R3938:Pirb	UTSW	7	3717638	missense	probably benign
R4119:Pirb	UTSW	7	3717575	missense	probably damaging	1.00
R4174:Pirb	UTSW	7	3716032	critical splice donor site	probably null
R4248:Pirb	UTSW	7	3719298	missense	probably damaging	1.00
R4827:Pirb	UTSW	7	3717603	missense	probably benign
R4828:Pirb	UTSW	7	3717603	missense	probably benign
R4829:Pirb	UTSW	7	3717603	missense	probably benign
R4830:Pirb	UTSW	7	3717603	missense	probably benign
R4870:Pirb	UTSW	7	3712662	missense	probably benign	0.00
R4909:Pirb	UTSW	7	3719362	nonsense	probably null
R5244:Pirb	UTSW	7	3716063	missense	probably benign	0.32
R5323:Pirb	UTSW	7	3716599	missense	possibly damaging	0.85
R5921:Pirb	UTSW	7	3716694	nonsense	probably null
R6316:Pirb	UTSW	7	3717823	missense	probably damaging	1.00
R6502:Pirb	UTSW	7	3717393	missense	probably benign	0.00
R6811:Pirb	UTSW	7	3719642	missense	possibly damaging	0.91
R7216:Pirb	UTSW	7	3716274	missense	probably benign	0.00
R7275:Pirb	UTSW	7	3716178	missense	probably benign	0.00
R7327:Pirb	UTSW	7	3717188	nonsense	probably null
R7582:Pirb	UTSW	7	3713818	critical splice donor site	probably null
R7717:Pirb	UTSW	7	3717783	missense	not run
R7717:Pirb	UTSW	7	3717801	missense	not run
R7807:Pirb	UTSW	7	3719865	missense	possibly damaging	0.55
R7844:Pirb	UTSW	7	3719411	nonsense	probably null
R7927:Pirb	UTSW	7	3719411	nonsense	probably null
X0025:Pirb	UTSW	7	3717268	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGATGAGCTCAAAAGTTCTAAGTCC -3'
(R):5'- ATGTGACCTATGCCCAGCTG -3'

Sequencing Primer
(F):5'- GGCATGCAATTCCAAGCTTG -3'
(R):5'- TGTGCAGCAGGACACTCAGAC -3'

Posted On

2016-06-21