Mutagenetix > Incidental Mutation

Incidental Mutation 'R5146:Itfg1'

395116

Institutional Source

Beutler Lab

Gene Symbol

Itfg1

Ensembl Gene

ENSMUSG00000031703

Gene Name

integrin alpha FG-GAP repeat containing 1

Synonyms

D8Wsu49e, 2310047C21Rik

MMRRC Submission

042730-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.115) question?

Stock #

R5146 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85717578-85840921 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to C at 85718868 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Tryptophan at position 611 (*611W)

Ref Sequence

ENSEMBL: ENSMUSP00000034140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034140]

AlphaFold

Q99KW9

Predicted Effect

probably null
Transcript: ENSMUST00000034140
AA Change: *611W

SMART Domains

Protein: ENSMUSP00000034140
Gene: ENSMUSG00000031703
AA Change: *611W

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
SCOP:d1m1xa4	46	232	5e-3	SMART
low complexity region	482	496	N/A	INTRINSIC
transmembrane domain	564	586	N/A	INTRINSIC

Meta Mutation Damage Score

0.9578

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

97% (35/36)

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	A	G	12: 71,243,025	D1498G	possibly damaging	Het
Adcyap1r1	A	G	6: 55,484,972	I329V	probably benign	Het
Ahnak2	A	C	12: 112,775,726	H637Q	probably benign	Het
Carmil3	A	G	14: 55,497,179	D455G	probably benign	Het
Cdh7	A	G	1: 109,994,312	T45A	probably damaging	Het
Chil4	T	A	3: 106,202,834	T315S	probably benign	Het
Cntnap5c	T	C	17: 58,013,847	V138A	probably damaging	Het
Csmd1	T	C	8: 16,196,190	D1065G	probably damaging	Het
Cspp1	C	T	1: 10,074,876	R296*	probably null	Het
Dnah17	A	G	11: 118,114,179	M793T	probably damaging	Het
Dock4	A	G	12: 40,649,492		probably null	Het
Fgfr4	G	T	13: 55,165,912	L511F	probably damaging	Het
Gm14415	T	C	2: 177,104,231		noncoding transcript	Het
Gm7030	A	G	17: 36,129,015	W76R	probably damaging	Het
Gpam	A	G	19: 55,093,946	V91A	probably damaging	Het
Grin2b	T	A	6: 135,779,342	I462F	probably damaging	Het
Grwd1	A	T	7: 45,827,834	F210I	probably damaging	Het
Kcna2	T	C	3: 107,105,498	V465A	probably benign	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Myo15b	A	G	11: 115,891,198	T1444A	probably benign	Het
Nlgn3	G	A	X: 101,318,285	V287I	probably benign	Het
Oas1c	A	G	5: 120,802,094	S336P	probably benign	Het
Pirb	T	C	7: 3,712,621		probably benign	Het
Pot1b	A	T	17: 55,672,865	Y330*	probably null	Het
Rnf20	A	T	4: 49,651,456	M641L	probably benign	Het
Sppl2b	T	C	10: 80,867,640	*579Q	probably null	Het
Sumf1	G	A	6: 108,185,310	P83S	probably benign	Het
Tmem101	C	T	11: 102,154,624	R133Q	probably benign	Het
Ttn	G	A	2: 76,870,363		probably benign	Het
Vmn2r84	A	G	10: 130,386,102	Y750H	probably damaging	Het
Zfp873	A	G	10: 82,060,224	Y300C	probably damaging	Het

Other mutations in Itfg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02579:Itfg1	APN	8	85780565	missense	possibly damaging	0.95
IGL02803:Itfg1	APN	8	85725511	splice site	probably null
R0368:Itfg1	UTSW	8	85764407	missense	probably damaging	1.00
R0755:Itfg1	UTSW	8	85726205	missense	possibly damaging	0.90
R1183:Itfg1	UTSW	8	85780523	missense	probably benign	0.04
R1529:Itfg1	UTSW	8	85810614	missense	probably benign	0.02
R1789:Itfg1	UTSW	8	85725512	critical splice donor site	probably null
R1953:Itfg1	UTSW	8	85831231	missense	probably benign	0.31
R2206:Itfg1	UTSW	8	85776198	missense	probably benign	0.17
R2207:Itfg1	UTSW	8	85776198	missense	probably benign	0.17
R2260:Itfg1	UTSW	8	85722677	missense	probably damaging	1.00
R2358:Itfg1	UTSW	8	85738129	missense	probably damaging	1.00
R2876:Itfg1	UTSW	8	85780510	splice site	probably benign
R2990:Itfg1	UTSW	8	85835049	missense	possibly damaging	0.82
R4484:Itfg1	UTSW	8	85726249	missense	probably damaging	1.00
R4762:Itfg1	UTSW	8	85732441	missense	possibly damaging	0.95
R5796:Itfg1	UTSW	8	85718893	missense	probably damaging	1.00
R5805:Itfg1	UTSW	8	85766972	missense	probably benign	0.04
R6084:Itfg1	UTSW	8	85726170	missense	probably benign	0.01
R6187:Itfg1	UTSW	8	85836465	missense	probably damaging	1.00
R6319:Itfg1	UTSW	8	85840629	missense	probably damaging	1.00
R6463:Itfg1	UTSW	8	85736151	missense	probably benign	0.03
R6490:Itfg1	UTSW	8	85740301	missense	probably benign	0.08
R6492:Itfg1	UTSW	8	85740349	missense	probably benign	0.14
R6588:Itfg1	UTSW	8	85736130	missense	probably benign
R6753:Itfg1	UTSW	8	85835078	missense	probably benign	0.04
R7489:Itfg1	UTSW	8	85767001	missense	probably damaging	1.00
R7665:Itfg1	UTSW	8	85764350	missense	probably benign
R7912:Itfg1	UTSW	8	85764280	missense	probably damaging	1.00
R7985:Itfg1	UTSW	8	85725568	missense	probably damaging	1.00
R8927:Itfg1	UTSW	8	85840791	unclassified	probably benign
R8928:Itfg1	UTSW	8	85840791	unclassified	probably benign
R9080:Itfg1	UTSW	8	85740245	missense	possibly damaging	0.82
R9456:Itfg1	UTSW	8	85838937	missense	probably benign	0.01
R9513:Itfg1	UTSW	8	85764246	missense	possibly damaging	0.92
R9577:Itfg1	UTSW	8	85776169	missense	probably benign	0.01
R9761:Itfg1	UTSW	8	85836402	missense	probably benign	0.00
X0067:Itfg1	UTSW	8	85840753	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- AACACAAATGCTCAGTGCTGC -3'
(R):5'- ATGTTTACTCTCACCTTCAAGTTGG -3'

Sequencing Primer
(F):5'- GCTCAGTGCTGCTAAATTAAGAACC -3'
(R):5'- TCTCACCTTCAAGTTGGTTATAAATG -3'

Posted On

2016-06-21