Incidental Mutation 'R5146:Itfg1'
ID395116
Institutional Source Beutler Lab
Gene Symbol Itfg1
Ensembl Gene ENSMUSG00000031703
Gene Nameintegrin alpha FG-GAP repeat containing 1
SynonymsD8Wsu49e, 2310047C21Rik
MMRRC Submission 042730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5146 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85717578-85840921 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 85718868 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 611 (*611W)
Ref Sequence ENSEMBL: ENSMUSP00000034140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034140]
Predicted Effect probably null
Transcript: ENSMUST00000034140
AA Change: *611W
SMART Domains Protein: ENSMUSP00000034140
Gene: ENSMUSG00000031703
AA Change: *611W

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SCOP:d1m1xa4 46 232 5e-3 SMART
low complexity region 482 496 N/A INTRINSIC
transmembrane domain 564 586 N/A INTRINSIC
Meta Mutation Damage Score 0.9578 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,243,025 D1498G possibly damaging Het
Adcyap1r1 A G 6: 55,484,972 I329V probably benign Het
Ahnak2 A C 12: 112,775,726 H637Q probably benign Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Cdh7 A G 1: 109,994,312 T45A probably damaging Het
Chil4 T A 3: 106,202,834 T315S probably benign Het
Cntnap5c T C 17: 58,013,847 V138A probably damaging Het
Csmd1 T C 8: 16,196,190 D1065G probably damaging Het
Cspp1 C T 1: 10,074,876 R296* probably null Het
Dnah17 A G 11: 118,114,179 M793T probably damaging Het
Dock4 A G 12: 40,649,492 probably null Het
Fgfr4 G T 13: 55,165,912 L511F probably damaging Het
Gm14415 T C 2: 177,104,231 noncoding transcript Het
Gm7030 A G 17: 36,129,015 W76R probably damaging Het
Gpam A G 19: 55,093,946 V91A probably damaging Het
Grin2b T A 6: 135,779,342 I462F probably damaging Het
Grwd1 A T 7: 45,827,834 F210I probably damaging Het
Kcna2 T C 3: 107,105,498 V465A probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Myo15b A G 11: 115,891,198 T1444A probably benign Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Oas1c A G 5: 120,802,094 S336P probably benign Het
Pirb T C 7: 3,712,621 probably benign Het
Pot1b A T 17: 55,672,865 Y330* probably null Het
Rnf20 A T 4: 49,651,456 M641L probably benign Het
Sppl2b T C 10: 80,867,640 *579Q probably null Het
Sumf1 G A 6: 108,185,310 P83S probably benign Het
Tmem101 C T 11: 102,154,624 R133Q probably benign Het
Ttn G A 2: 76,870,363 probably benign Het
Vmn2r84 A G 10: 130,386,102 Y750H probably damaging Het
Zfp873 A G 10: 82,060,224 Y300C probably damaging Het
Other mutations in Itfg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02579:Itfg1 APN 8 85780565 missense possibly damaging 0.95
IGL02803:Itfg1 APN 8 85725511 splice site probably null
R0368:Itfg1 UTSW 8 85764407 missense probably damaging 1.00
R0755:Itfg1 UTSW 8 85726205 missense possibly damaging 0.90
R1183:Itfg1 UTSW 8 85780523 missense probably benign 0.04
R1529:Itfg1 UTSW 8 85810614 missense probably benign 0.02
R1789:Itfg1 UTSW 8 85725512 critical splice donor site probably null
R1953:Itfg1 UTSW 8 85831231 missense probably benign 0.31
R2206:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2207:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2260:Itfg1 UTSW 8 85722677 missense probably damaging 1.00
R2358:Itfg1 UTSW 8 85738129 missense probably damaging 1.00
R2876:Itfg1 UTSW 8 85780510 splice site probably benign
R2990:Itfg1 UTSW 8 85835049 missense possibly damaging 0.82
R4484:Itfg1 UTSW 8 85726249 missense probably damaging 1.00
R4762:Itfg1 UTSW 8 85732441 missense possibly damaging 0.95
R5796:Itfg1 UTSW 8 85718893 missense probably damaging 1.00
R5805:Itfg1 UTSW 8 85766972 missense probably benign 0.04
R6084:Itfg1 UTSW 8 85726170 missense probably benign 0.01
R6187:Itfg1 UTSW 8 85836465 missense probably damaging 1.00
R6319:Itfg1 UTSW 8 85840629 missense probably damaging 1.00
R6463:Itfg1 UTSW 8 85736151 missense probably benign 0.03
R6490:Itfg1 UTSW 8 85740301 missense probably benign 0.08
R6492:Itfg1 UTSW 8 85740349 missense probably benign 0.14
R6588:Itfg1 UTSW 8 85736130 missense probably benign
R6753:Itfg1 UTSW 8 85835078 missense probably benign 0.04
R7489:Itfg1 UTSW 8 85767001 missense probably damaging 1.00
R7665:Itfg1 UTSW 8 85764350 missense probably benign
R7912:Itfg1 UTSW 8 85764280 missense probably damaging 1.00
R7985:Itfg1 UTSW 8 85725568 missense probably damaging 1.00
X0067:Itfg1 UTSW 8 85840753 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AACACAAATGCTCAGTGCTGC -3'
(R):5'- ATGTTTACTCTCACCTTCAAGTTGG -3'

Sequencing Primer
(F):5'- GCTCAGTGCTGCTAAATTAAGAACC -3'
(R):5'- TCTCACCTTCAAGTTGGTTATAAATG -3'
Posted On2016-06-21