Incidental Mutation 'R5146:Tmem101'
ID395120
Institutional Source Beutler Lab
Gene Symbol Tmem101
Ensembl Gene ENSMUSG00000020921
Gene Nametransmembrane protein 101
Synonyms
MMRRC Submission 042730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R5146 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102152546-102156404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102154624 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 133 (R133Q)
Ref Sequence ENSEMBL: ENSMUSP00000021296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021296]
Predicted Effect probably benign
Transcript: ENSMUST00000021296
AA Change: R133Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021296
Gene: ENSMUSG00000020921
AA Change: R133Q

DomainStartEndE-ValueType
Pfam:TMEM101 8 256 9.9e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143986
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,243,025 D1498G possibly damaging Het
Adcyap1r1 A G 6: 55,484,972 I329V probably benign Het
Ahnak2 A C 12: 112,775,726 H637Q probably benign Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Cdh7 A G 1: 109,994,312 T45A probably damaging Het
Chil4 T A 3: 106,202,834 T315S probably benign Het
Cntnap5c T C 17: 58,013,847 V138A probably damaging Het
Csmd1 T C 8: 16,196,190 D1065G probably damaging Het
Cspp1 C T 1: 10,074,876 R296* probably null Het
Dnah17 A G 11: 118,114,179 M793T probably damaging Het
Dock4 A G 12: 40,649,492 probably null Het
Fgfr4 G T 13: 55,165,912 L511F probably damaging Het
Gm14415 T C 2: 177,104,231 noncoding transcript Het
Gm7030 A G 17: 36,129,015 W76R probably damaging Het
Gpam A G 19: 55,093,946 V91A probably damaging Het
Grin2b T A 6: 135,779,342 I462F probably damaging Het
Grwd1 A T 7: 45,827,834 F210I probably damaging Het
Itfg1 T C 8: 85,718,868 *611W probably null Het
Kcna2 T C 3: 107,105,498 V465A probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Myo15b A G 11: 115,891,198 T1444A probably benign Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Oas1c A G 5: 120,802,094 S336P probably benign Het
Pirb T C 7: 3,712,621 probably benign Het
Pot1b A T 17: 55,672,865 Y330* probably null Het
Rnf20 A T 4: 49,651,456 M641L probably benign Het
Sppl2b T C 10: 80,867,640 *579Q probably null Het
Sumf1 G A 6: 108,185,310 P83S probably benign Het
Ttn G A 2: 76,870,363 probably benign Het
Vmn2r84 A G 10: 130,386,102 Y750H probably damaging Het
Zfp873 A G 10: 82,060,224 Y300C probably damaging Het
Other mutations in Tmem101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Tmem101 APN 11 102154660 missense probably damaging 0.99
IGL01096:Tmem101 APN 11 102154552 splice site probably null
IGL01593:Tmem101 APN 11 102155878 missense probably damaging 1.00
IGL01814:Tmem101 APN 11 102153458 missense possibly damaging 0.58
IGL02451:Tmem101 APN 11 102153293 missense probably damaging 1.00
IGL03238:Tmem101 APN 11 102155785 missense probably damaging 1.00
R0462:Tmem101 UTSW 11 102155867 missense probably benign 0.08
R0848:Tmem101 UTSW 11 102155866 missense possibly damaging 0.65
R1465:Tmem101 UTSW 11 102153329 missense probably damaging 0.97
R1465:Tmem101 UTSW 11 102153329 missense probably damaging 0.97
R1722:Tmem101 UTSW 11 102154693 missense probably damaging 1.00
R1928:Tmem101 UTSW 11 102153396 missense probably benign
R2082:Tmem101 UTSW 11 102153377 missense probably benign 0.17
R4577:Tmem101 UTSW 11 102155837 missense possibly damaging 0.48
R4724:Tmem101 UTSW 11 102153443 missense probably benign 0.32
R4729:Tmem101 UTSW 11 102156329 missense probably benign 0.25
R5184:Tmem101 UTSW 11 102156233 missense possibly damaging 0.78
R7381:Tmem101 UTSW 11 102153350 missense possibly damaging 0.91
R8799:Tmem101 UTSW 11 102153510 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCAATCTCTTGGAGTCACCTTG -3'
(R):5'- CTTGGAATAGGCAAGAGGGTTC -3'

Sequencing Primer
(F):5'- GTGAAATTACTCACAAGGCCTTGCTC -3'
(R):5'- TTCATCAGATAGAACAGGACGTG -3'
Posted On2016-06-21