Incidental Mutation 'R5146:Myo15b'
ID 395121
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Name myosin XVB
Synonyms LOC217328, LOC380737, E330039G21Rik
MMRRC Submission 042730-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R5146 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 115749232-115783429 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115782024 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1444 (T1444A)
Ref Sequence ENSEMBL: ENSMUSP00000152405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000040703] [ENSMUST00000093911] [ENSMUST00000125835] [ENSMUST00000131578] [ENSMUST00000167507] [ENSMUST00000222123] [ENSMUST00000140174]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000021097
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040703
SMART Domains Protein: ENSMUSP00000048072
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
low complexity region 93 111 N/A INTRINSIC
low complexity region 179 213 N/A INTRINSIC
low complexity region 250 289 N/A INTRINSIC
low complexity region 345 370 N/A INTRINSIC
low complexity region 497 511 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
Blast:MYSc 587 775 3e-15 BLAST
SH3 778 835 1.15e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000093911
AA Change: T2866A
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427
AA Change: T2866A

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125835
SMART Domains Protein: ENSMUSP00000144423
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
SH3 75 132 7e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131578
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132447
Predicted Effect probably benign
Transcript: ENSMUST00000167507
AA Change: T344A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427
AA Change: T344A

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136774
Predicted Effect probably benign
Transcript: ENSMUST00000222123
AA Change: T1444A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000140174
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,289,799 (GRCm39) D1498G possibly damaging Het
Adcyap1r1 A G 6: 55,461,957 (GRCm39) I329V probably benign Het
Ahnak2 A C 12: 112,742,160 (GRCm39) H637Q probably benign Het
Carmil3 A G 14: 55,734,636 (GRCm39) D455G probably benign Het
Cdh20 A G 1: 109,922,042 (GRCm39) T45A probably damaging Het
Chil4 T A 3: 106,110,150 (GRCm39) T315S probably benign Het
Cntnap5c T C 17: 58,320,842 (GRCm39) V138A probably damaging Het
Csmd1 T C 8: 16,246,204 (GRCm39) D1065G probably damaging Het
Cspp1 C T 1: 10,145,101 (GRCm39) R296* probably null Het
Dnah17 A G 11: 118,005,005 (GRCm39) M793T probably damaging Het
Dock4 A G 12: 40,699,491 (GRCm39) probably null Het
Fgfr4 G T 13: 55,313,725 (GRCm39) L511F probably damaging Het
Gm14415 T C 2: 176,796,024 (GRCm39) noncoding transcript Het
Gpam A G 19: 55,082,378 (GRCm39) V91A probably damaging Het
Grin2b T A 6: 135,756,340 (GRCm39) I462F probably damaging Het
Grwd1 A T 7: 45,477,258 (GRCm39) F210I probably damaging Het
H2-T9 A G 17: 36,439,907 (GRCm39) W76R probably damaging Het
Itfg1 T C 8: 86,445,497 (GRCm39) *611W probably null Het
Kcna2 T C 3: 107,012,814 (GRCm39) V465A probably benign Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Nlgn3 G A X: 100,361,891 (GRCm39) V287I probably benign Het
Oas1c A G 5: 120,940,159 (GRCm39) S336P probably benign Het
Pirb T C 7: 3,715,620 (GRCm39) probably benign Het
Pot1b A T 17: 55,979,865 (GRCm39) Y330* probably null Het
Rnf20 A T 4: 49,651,456 (GRCm39) M641L probably benign Het
Sppl2b T C 10: 80,703,474 (GRCm39) *579Q probably null Het
Sumf1 G A 6: 108,162,271 (GRCm39) P83S probably benign Het
Tmem101 C T 11: 102,045,450 (GRCm39) R133Q probably benign Het
Ttn G A 2: 76,700,707 (GRCm39) probably benign Het
Vmn2r84 A G 10: 130,221,971 (GRCm39) Y750H probably damaging Het
Zfp873 A G 10: 81,896,058 (GRCm39) Y300C probably damaging Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115,782,742 (GRCm39) missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115,760,330 (GRCm39) nonsense probably null
IGL01539:Myo15b APN 11 115,754,299 (GRCm39) missense probably benign 0.43
IGL01895:Myo15b APN 11 115,774,324 (GRCm39) missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115,777,109 (GRCm39) missense probably damaging 1.00
IGL02343:Myo15b APN 11 115,764,226 (GRCm39) unclassified probably benign
IGL02349:Myo15b APN 11 115,753,931 (GRCm39) splice site probably benign
IGL02368:Myo15b APN 11 115,767,828 (GRCm39) missense probably benign 0.13
IGL02576:Myo15b APN 11 115,780,879 (GRCm39) missense probably null 0.97
IGL02650:Myo15b APN 11 115,777,337 (GRCm39) critical splice donor site probably null
IGL02661:Myo15b APN 11 115,774,895 (GRCm39) missense probably benign 0.01
IGL02716:Myo15b APN 11 115,774,535 (GRCm39) missense probably benign 0.06
IGL02733:Myo15b APN 11 115,775,076 (GRCm39) missense probably benign 0.00
IGL02951:Myo15b APN 11 115,772,127 (GRCm39) missense probably damaging 1.00
IGL03017:Myo15b APN 11 115,778,743 (GRCm39) missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115,762,469 (GRCm39) missense probably benign 0.08
ANU74:Myo15b UTSW 11 115,769,239 (GRCm39) missense probably damaging 1.00
R0092:Myo15b UTSW 11 115,753,812 (GRCm39) missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115,777,109 (GRCm39) missense probably damaging 1.00
R0325:Myo15b UTSW 11 115,775,091 (GRCm39) missense probably damaging 1.00
R0614:Myo15b UTSW 11 115,773,739 (GRCm39) missense probably damaging 1.00
R0652:Myo15b UTSW 11 115,755,468 (GRCm39) missense probably benign 0.07
R0711:Myo15b UTSW 11 115,774,664 (GRCm39) missense probably damaging 1.00
R0815:Myo15b UTSW 11 115,757,162 (GRCm39) splice site probably benign
R0961:Myo15b UTSW 11 115,773,280 (GRCm39) missense probably benign 0.15
R1066:Myo15b UTSW 11 115,770,577 (GRCm39) missense probably benign 0.03
R1221:Myo15b UTSW 11 115,777,546 (GRCm39) missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115,771,327 (GRCm39) missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115,774,318 (GRCm39) small deletion probably benign
R1313:Myo15b UTSW 11 115,775,955 (GRCm39) missense probably damaging 1.00
R1313:Myo15b UTSW 11 115,775,955 (GRCm39) missense probably damaging 1.00
R1317:Myo15b UTSW 11 115,774,460 (GRCm39) missense probably null 0.14
R1491:Myo15b UTSW 11 115,777,683 (GRCm39) splice site probably null
R1552:Myo15b UTSW 11 115,757,461 (GRCm39) missense probably benign 0.08
R1731:Myo15b UTSW 11 115,782,386 (GRCm39) missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115,771,335 (GRCm39) critical splice donor site probably null
R1843:Myo15b UTSW 11 115,760,412 (GRCm39) missense probably benign 0.04
R1888:Myo15b UTSW 11 115,777,899 (GRCm39) missense probably damaging 1.00
R1888:Myo15b UTSW 11 115,777,899 (GRCm39) missense probably damaging 1.00
R1894:Myo15b UTSW 11 115,777,899 (GRCm39) missense probably damaging 1.00
R1917:Myo15b UTSW 11 115,773,080 (GRCm39) missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115,754,310 (GRCm39) missense probably benign 0.30
R1939:Myo15b UTSW 11 115,778,529 (GRCm39) missense probably benign 0.00
R1945:Myo15b UTSW 11 115,769,224 (GRCm39) missense probably damaging 1.00
R1986:Myo15b UTSW 11 115,773,701 (GRCm39) missense probably benign 0.31
R2130:Myo15b UTSW 11 115,762,469 (GRCm39) missense probably benign 0.08
R2138:Myo15b UTSW 11 115,774,633 (GRCm39) missense probably benign 0.00
R2176:Myo15b UTSW 11 115,757,398 (GRCm39) missense probably damaging 1.00
R2415:Myo15b UTSW 11 115,770,390 (GRCm39) missense probably benign 0.00
R2483:Myo15b UTSW 11 115,755,565 (GRCm39) missense probably benign 0.04
R3620:Myo15b UTSW 11 115,762,013 (GRCm39) missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115,754,239 (GRCm39) missense probably benign 0.01
R4013:Myo15b UTSW 11 115,762,282 (GRCm39) nonsense probably null
R4021:Myo15b UTSW 11 115,764,331 (GRCm39) missense probably benign 0.07
R4119:Myo15b UTSW 11 115,764,318 (GRCm39) missense probably benign 0.07
R4120:Myo15b UTSW 11 115,764,318 (GRCm39) missense probably benign 0.07
R4499:Myo15b UTSW 11 115,781,778 (GRCm39) missense probably benign 0.00
R4653:Myo15b UTSW 11 115,770,813 (GRCm39) critical splice donor site probably null
R4655:Myo15b UTSW 11 115,781,523 (GRCm39) missense probably damaging 1.00
R4700:Myo15b UTSW 11 115,752,761 (GRCm39) missense possibly damaging 0.55
R4702:Myo15b UTSW 11 115,774,834 (GRCm39) missense probably benign 0.01
R4777:Myo15b UTSW 11 115,770,478 (GRCm39) missense probably damaging 0.99
R4833:Myo15b UTSW 11 115,778,428 (GRCm39) missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115,757,482 (GRCm39) missense probably benign 0.01
R5121:Myo15b UTSW 11 115,776,880 (GRCm39) missense probably damaging 1.00
R5535:Myo15b UTSW 11 115,772,127 (GRCm39) missense probably damaging 1.00
R5647:Myo15b UTSW 11 115,762,337 (GRCm39) missense probably damaging 0.99
R5849:Myo15b UTSW 11 115,772,759 (GRCm39) missense probably damaging 1.00
R5882:Myo15b UTSW 11 115,760,422 (GRCm39) missense probably damaging 1.00
R5956:Myo15b UTSW 11 115,764,583 (GRCm39) missense probably benign 0.34
R6273:Myo15b UTSW 11 115,753,625 (GRCm39) missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115,777,065 (GRCm39) missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115,781,657 (GRCm39) missense probably damaging 1.00
R6462:Myo15b UTSW 11 115,750,268 (GRCm39) missense probably benign 0.01
R6792:Myo15b UTSW 11 115,775,923 (GRCm39) missense probably damaging 1.00
R6963:Myo15b UTSW 11 115,781,540 (GRCm39) splice site probably null
R7015:Myo15b UTSW 11 115,762,670 (GRCm39) missense
R7020:Myo15b UTSW 11 115,757,493 (GRCm39) nonsense probably null
R7096:Myo15b UTSW 11 115,782,324 (GRCm39) splice site probably null
R7219:Myo15b UTSW 11 115,767,921 (GRCm39) critical splice donor site probably null
R7400:Myo15b UTSW 11 115,750,939 (GRCm39) missense
R7413:Myo15b UTSW 11 115,768,970 (GRCm39) missense
R7483:Myo15b UTSW 11 115,749,570 (GRCm39) missense
R7523:Myo15b UTSW 11 115,781,684 (GRCm39) missense unknown
R7737:Myo15b UTSW 11 115,778,749 (GRCm39) missense unknown
R7784:Myo15b UTSW 11 115,752,166 (GRCm39) missense
R7842:Myo15b UTSW 11 115,762,321 (GRCm39) missense
R7921:Myo15b UTSW 11 115,778,004 (GRCm39) nonsense probably null
R8065:Myo15b UTSW 11 115,778,769 (GRCm39) critical splice donor site probably null
R8183:Myo15b UTSW 11 115,773,843 (GRCm39) splice site probably null
R8193:Myo15b UTSW 11 115,775,973 (GRCm39) missense probably damaging 1.00
R8237:Myo15b UTSW 11 115,767,827 (GRCm39) missense
R8430:Myo15b UTSW 11 115,773,049 (GRCm39) missense probably benign 0.02
R8482:Myo15b UTSW 11 115,774,083 (GRCm39) nonsense probably null
R8515:Myo15b UTSW 11 115,749,610 (GRCm39) missense
R8798:Myo15b UTSW 11 115,754,232 (GRCm39) missense
R8937:Myo15b UTSW 11 115,773,127 (GRCm39) missense probably benign 0.00
R8975:Myo15b UTSW 11 115,781,780 (GRCm39) missense unknown
R9045:Myo15b UTSW 11 115,783,178 (GRCm39) makesense probably null
R9117:Myo15b UTSW 11 115,778,743 (GRCm39) missense possibly damaging 0.91
R9185:Myo15b UTSW 11 115,771,255 (GRCm39) missense unknown
R9226:Myo15b UTSW 11 115,750,924 (GRCm39) missense
R9302:Myo15b UTSW 11 115,776,238 (GRCm39) missense possibly damaging 0.83
R9318:Myo15b UTSW 11 115,775,965 (GRCm39) missense probably benign 0.26
R9336:Myo15b UTSW 11 115,771,064 (GRCm39) missense
R9337:Myo15b UTSW 11 115,749,861 (GRCm39) missense
R9338:Myo15b UTSW 11 115,762,238 (GRCm39) missense
R9498:Myo15b UTSW 11 115,770,784 (GRCm39) missense
R9500:Myo15b UTSW 11 115,777,466 (GRCm39) missense probably damaging 0.98
R9602:Myo15b UTSW 11 115,769,269 (GRCm39) critical splice donor site probably null
R9642:Myo15b UTSW 11 115,772,335 (GRCm39) missense possibly damaging 0.67
X0020:Myo15b UTSW 11 115,762,625 (GRCm39) critical splice acceptor site probably null
Z1176:Myo15b UTSW 11 115,778,751 (GRCm39) missense unknown
Z1176:Myo15b UTSW 11 115,774,278 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TAGACTCCCCTCTCTACAATGACG -3'
(R):5'- TAATGCCTGGCACCTATTCCG -3'

Sequencing Primer
(F):5'- TCTCTACAATGACGCTCTGTGACAAG -3'
(R):5'- CTATTCCGGATAATGACCCTGGG -3'
Posted On 2016-06-21