Incidental Mutation 'R5146:2700049A03Rik'
ID395124
Institutional Source Beutler Lab
Gene Symbol 2700049A03Rik
Ensembl Gene ENSMUSG00000034601
Gene NameRIKEN cDNA 2700049A03 gene
Synonymstalpid3
MMRRC Submission 042730-MU
Accession Numbers

Genbank: NM_001163378, NM_029818

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5146 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location71136848-71243303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71243025 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1498 (D1498G)
Ref Sequence ENSEMBL: ENSMUSP00000118956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045907
AA Change: D1410G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: D1410G

DomainStartEndE-ValueType
Pfam:TALPID3 116 1351 N/A PFAM
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000149564
AA Change: D1498G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: D1498G

DomainStartEndE-ValueType
Pfam:TALPID3 116 1349 N/A PFAM
Meta Mutation Damage Score 0.0910 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A G 6: 55,484,972 I329V probably benign Het
Ahnak2 A C 12: 112,775,726 H637Q probably benign Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Cdh7 A G 1: 109,994,312 T45A probably damaging Het
Chil4 T A 3: 106,202,834 T315S probably benign Het
Cntnap5c T C 17: 58,013,847 V138A probably damaging Het
Csmd1 T C 8: 16,196,190 D1065G probably damaging Het
Cspp1 C T 1: 10,074,876 R296* probably null Het
Dnah17 A G 11: 118,114,179 M793T probably damaging Het
Dock4 A G 12: 40,649,492 probably null Het
Fgfr4 G T 13: 55,165,912 L511F probably damaging Het
Gm14415 T C 2: 177,104,231 noncoding transcript Het
Gm7030 A G 17: 36,129,015 W76R probably damaging Het
Gpam A G 19: 55,093,946 V91A probably damaging Het
Grin2b T A 6: 135,779,342 I462F probably damaging Het
Grwd1 A T 7: 45,827,834 F210I probably damaging Het
Itfg1 T C 8: 85,718,868 *611W probably null Het
Kcna2 T C 3: 107,105,498 V465A probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Myo15b A G 11: 115,891,198 T1444A probably benign Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Oas1c A G 5: 120,802,094 S336P probably benign Het
Pirb T C 7: 3,712,621 probably benign Het
Pot1b A T 17: 55,672,865 Y330* probably null Het
Rnf20 A T 4: 49,651,456 M641L probably benign Het
Sppl2b T C 10: 80,867,640 *579Q probably null Het
Sumf1 G A 6: 108,185,310 P83S probably benign Het
Tmem101 C T 11: 102,154,624 R133Q probably benign Het
Ttn G A 2: 76,870,363 probably benign Het
Vmn2r84 A G 10: 130,386,102 Y750H probably damaging Het
Zfp873 A G 10: 82,060,224 Y300C probably damaging Het
Other mutations in 2700049A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:2700049A03Rik APN 12 71167119 missense probably benign 0.00
IGL01107:2700049A03Rik APN 12 71194468 critical splice donor site probably null
IGL01404:2700049A03Rik APN 12 71164378 splice site probably null
IGL01835:2700049A03Rik APN 12 71167181 nonsense probably null
IGL01835:2700049A03Rik APN 12 71167183 missense probably benign 0.00
IGL02122:2700049A03Rik APN 12 71170525 missense possibly damaging 0.93
IGL02140:2700049A03Rik APN 12 71148260 missense probably benign 0.06
IGL02385:2700049A03Rik APN 12 71154856 missense probably damaging 0.98
IGL03181:2700049A03Rik APN 12 71193373 missense possibly damaging 0.51
IGL03253:2700049A03Rik APN 12 71140883 missense probably benign 0.33
IGL03278:2700049A03Rik APN 12 71158825 splice site probably benign
G4846:2700049A03Rik UTSW 12 71137909 missense probably benign
PIT1430001:2700049A03Rik UTSW 12 71160386 missense possibly damaging 0.71
PIT4519001:2700049A03Rik UTSW 12 71170666 missense probably benign 0.05
R0108:2700049A03Rik UTSW 12 71177918 missense probably benign 0.14
R0165:2700049A03Rik UTSW 12 71167150 missense possibly damaging 0.52
R0211:2700049A03Rik UTSW 12 71216096 missense possibly damaging 0.96
R0211:2700049A03Rik UTSW 12 71216096 missense possibly damaging 0.96
R0220:2700049A03Rik UTSW 12 71148420 critical splice donor site probably null
R0352:2700049A03Rik UTSW 12 71138030 missense possibly damaging 0.96
R0468:2700049A03Rik UTSW 12 71193310 missense possibly damaging 0.71
R0508:2700049A03Rik UTSW 12 71164388 missense probably damaging 0.98
R0673:2700049A03Rik UTSW 12 71177868 missense probably damaging 0.97
R0840:2700049A03Rik UTSW 12 71158883 missense probably benign 0.16
R0893:2700049A03Rik UTSW 12 71219308 splice site probably benign
R1244:2700049A03Rik UTSW 12 71216144 missense probably benign 0.25
R1432:2700049A03Rik UTSW 12 71170587 unclassified probably null
R1599:2700049A03Rik UTSW 12 71150259 missense probably damaging 0.98
R1732:2700049A03Rik UTSW 12 71219221 missense probably benign 0.18
R1820:2700049A03Rik UTSW 12 71150244 missense possibly damaging 0.51
R1939:2700049A03Rik UTSW 12 71160412 splice site probably null
R1998:2700049A03Rik UTSW 12 71188619 missense possibly damaging 0.86
R2337:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2337:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2340:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2340:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2382:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2382:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2384:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2384:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2445:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2445:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2449:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2449:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2512:2700049A03Rik UTSW 12 71173171 missense possibly damaging 0.71
R2872:2700049A03Rik UTSW 12 71154756 splice site probably benign
R3236:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3236:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3237:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3237:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3734:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3734:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3808:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3808:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3809:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3809:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3944:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3944:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3959:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3959:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3960:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3960:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4593:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4593:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4595:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4595:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4596:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4596:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4600:2700049A03Rik UTSW 12 71148263 missense possibly damaging 0.67
R4649:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4649:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4651:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4652:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4652:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4714:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4714:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4735:2700049A03Rik UTSW 12 71216123 missense possibly damaging 0.88
R4810:2700049A03Rik UTSW 12 71189442 missense possibly damaging 0.51
R4852:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4852:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4854:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4854:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4855:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4855:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4884:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4884:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4893:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4893:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4905:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4905:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4915:2700049A03Rik UTSW 12 71189646 missense possibly damaging 0.92
R4919:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4919:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4959:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4959:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4989:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4989:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5011:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5011:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5012:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5012:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5118:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5118:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5163:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5163:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5188:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5188:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5189:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71193349 missense possibly damaging 0.93
R5190:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5190:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5290:2700049A03Rik UTSW 12 71188791 missense probably benign 0.00
R5344:2700049A03Rik UTSW 12 71243027 missense probably benign
R5502:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5502:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5503:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5503:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5619:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5619:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5667:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5667:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5669:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5669:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5671:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5671:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5725:2700049A03Rik UTSW 12 71193319 missense probably benign 0.05
R5956:2700049A03Rik UTSW 12 71157119 missense possibly damaging 0.86
R6051:2700049A03Rik UTSW 12 71184530 missense possibly damaging 0.84
R6148:2700049A03Rik UTSW 12 71187426 missense possibly damaging 0.71
R6158:2700049A03Rik UTSW 12 71170636 missense possibly damaging 0.51
R6916:2700049A03Rik UTSW 12 71164544 missense possibly damaging 0.86
R7129:2700049A03Rik UTSW 12 71216230 intron probably null
R7168:2700049A03Rik UTSW 12 71216057 missense probably damaging 0.98
R7193:2700049A03Rik UTSW 12 71219189 critical splice acceptor site probably null
R7200:2700049A03Rik UTSW 12 71140906 missense probably damaging 0.96
R7359:2700049A03Rik UTSW 12 71189574 missense possibly damaging 0.51
R7488:2700049A03Rik UTSW 12 71150405 missense possibly damaging 0.67
R7755:2700049A03Rik UTSW 12 71189413 missense probably benign 0.02
R7757:2700049A03Rik UTSW 12 71189413 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GATCCACGGTAAAGGGAAATTCC -3'
(R):5'- GCCAACAGTATACAGACATGGTC -3'

Sequencing Primer
(F):5'- AAGACATTTCCTTGTATGCGATCC -3'
(R):5'- TCTGCAGCCAGAGTGACATGTC -3'
Posted On2016-06-21