Mutagenetix > Incidental Mutation

Incidental Mutation 'R5146:Ahnak2'

395125

Institutional Source

Beutler Lab

Gene Symbol

Ahnak2

Ensembl Gene

ENSMUSG00000072812

Gene Name

AHNAK nucleoprotein 2

Synonyms

LOC382643

MMRRC Submission

042730-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R5146 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112772194-112802657 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 112775726 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 637 (H637Q)

Ref Sequence

ENSEMBL: ENSMUSP00000122404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101010] [ENSMUST00000128258]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000101010

SMART Domains

Protein: ENSMUSP00000098572
Gene: ENSMUSG00000072812

Domain	Start	End	E-Value	Type
low complexity region	5	14	N/A	INTRINSIC
low complexity region	364	375	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	717	733	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000128258
AA Change: H637Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000122404
Gene: ENSMUSG00000072812
AA Change: H637Q

Domain	Start	End	E-Value	Type
low complexity region	5	66	N/A	INTRINSIC
internal_repeat_1	67	251	2.35e-83	PROSPERO
low complexity region	285	308	N/A	INTRINSIC
low complexity region	371	389	N/A	INTRINSIC
internal_repeat_1	413	597	2.35e-83	PROSPERO
low complexity region	734	756	N/A	INTRINSIC
low complexity region	811	820	N/A	INTRINSIC
low complexity region	1170	1181	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1523	1539	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137195

SMART Domains

Protein: ENSMUSP00000116582
Gene: ENSMUSG00000072812

Domain	Start	End	E-Value	Type
internal_repeat_1	2	521	3.81e-221	PROSPERO
low complexity region	557	569	N/A	INTRINSIC
internal_repeat_1	606	1126	3.81e-221	PROSPERO

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

97% (35/36)

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	A	G	12: 71,243,025	D1498G	possibly damaging	Het
Adcyap1r1	A	G	6: 55,484,972	I329V	probably benign	Het
Carmil3	A	G	14: 55,497,179	D455G	probably benign	Het
Cdh7	A	G	1: 109,994,312	T45A	probably damaging	Het
Chil4	T	A	3: 106,202,834	T315S	probably benign	Het
Cntnap5c	T	C	17: 58,013,847	V138A	probably damaging	Het
Csmd1	T	C	8: 16,196,190	D1065G	probably damaging	Het
Cspp1	C	T	1: 10,074,876	R296*	probably null	Het
Dnah17	A	G	11: 118,114,179	M793T	probably damaging	Het
Dock4	A	G	12: 40,649,492		probably null	Het
Fgfr4	G	T	13: 55,165,912	L511F	probably damaging	Het
Gm14415	T	C	2: 177,104,231		noncoding transcript	Het
Gm7030	A	G	17: 36,129,015	W76R	probably damaging	Het
Gpam	A	G	19: 55,093,946	V91A	probably damaging	Het
Grin2b	T	A	6: 135,779,342	I462F	probably damaging	Het
Grwd1	A	T	7: 45,827,834	F210I	probably damaging	Het
Itfg1	T	C	8: 85,718,868	*611W	probably null	Het
Kcna2	T	C	3: 107,105,498	V465A	probably benign	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Myo15b	A	G	11: 115,891,198	T1444A	probably benign	Het
Nlgn3	G	A	X: 101,318,285	V287I	probably benign	Het
Oas1c	A	G	5: 120,802,094	S336P	probably benign	Het
Pirb	T	C	7: 3,712,621		probably benign	Het
Pot1b	A	T	17: 55,672,865	Y330*	probably null	Het
Rnf20	A	T	4: 49,651,456	M641L	probably benign	Het
Sppl2b	T	C	10: 80,867,640	*579Q	probably null	Het
Sumf1	G	A	6: 108,185,310	P83S	probably benign	Het
Tmem101	C	T	11: 102,154,624	R133Q	probably benign	Het
Ttn	G	A	2: 76,870,363		probably benign	Het
Vmn2r84	A	G	10: 130,386,102	Y750H	probably damaging	Het
Zfp873	A	G	10: 82,060,224	Y300C	probably damaging	Het

Other mutations in Ahnak2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02257:Ahnak2	APN	12	112785285	missense	possibly damaging	0.79
IGL02994:Ahnak2	APN	12	112786207	missense	probably damaging	0.99
PIT4480001:Ahnak2	UTSW	12	112773924	missense	possibly damaging	0.79
PIT4810001:Ahnak2	UTSW	12	112785594	missense
R0025:Ahnak2	UTSW	12	112785534	missense	probably damaging	0.99
R0025:Ahnak2	UTSW	12	112785534	missense	probably damaging	0.99
R0038:Ahnak2	UTSW	12	112774462	missense	probably benign	0.00
R0125:Ahnak2	UTSW	12	112785156	missense	probably benign	0.41
R1173:Ahnak2	UTSW	12	112785789	missense	probably damaging	1.00
R1494:Ahnak2	UTSW	12	112787950	missense	probably damaging	1.00
R1712:Ahnak2	UTSW	12	112785378	missense	probably benign	0.05
R1888:Ahnak2	UTSW	12	112773891	missense	possibly damaging	0.49
R1888:Ahnak2	UTSW	12	112773891	missense	possibly damaging	0.49
R2042:Ahnak2	UTSW	12	112785819	missense	probably damaging	0.98
R2056:Ahnak2	UTSW	12	112785006	missense	probably benign	0.00
R2417:Ahnak2	UTSW	12	112775371	missense	probably damaging	1.00
R2762:Ahnak2	UTSW	12	112785364	missense	probably damaging	0.96
R3618:Ahnak2	UTSW	12	112786222	missense	probably damaging	1.00
R3706:Ahnak2	UTSW	12	112773651	missense	possibly damaging	0.74
R3739:Ahnak2	UTSW	12	112774558	missense	probably benign	0.05
R3950:Ahnak2	UTSW	12	112785789	missense	probably damaging	1.00
R4485:Ahnak2	UTSW	12	112779767	unclassified	probably benign
R4651:Ahnak2	UTSW	12	112774837	missense	possibly damaging	0.93
R4652:Ahnak2	UTSW	12	112774837	missense	possibly damaging	0.93
R4831:Ahnak2	UTSW	12	112775749	missense	probably damaging	0.99
R4836:Ahnak2	UTSW	12	112774116	missense	probably damaging	1.00
R4837:Ahnak2	UTSW	12	112785739	missense	probably benign	0.00
R4864:Ahnak2	UTSW	12	112773606	missense	probably damaging	0.98
R4908:Ahnak2	UTSW	12	112775272	missense	probably benign	0.00
R5067:Ahnak2	UTSW	12	112785316	missense	probably benign	0.01
R5228:Ahnak2	UTSW	12	112775386	missense	probably benign	0.03
R5255:Ahnak2	UTSW	12	112773378	missense	possibly damaging	0.92
R5323:Ahnak2	UTSW	12	112779812	unclassified	probably benign
R5523:Ahnak2	UTSW	12	112775208	missense	probably damaging	1.00
R5733:Ahnak2	UTSW	12	112775666	nonsense	probably null
R5799:Ahnak2	UTSW	12	112778930	unclassified	probably benign
R5817:Ahnak2	UTSW	12	112774003	missense	probably damaging	1.00
R5835:Ahnak2	UTSW	12	112775796	missense	possibly damaging	0.66
R6083:Ahnak2	UTSW	12	112782612	missense	probably benign	0.06
R6083:Ahnak2	UTSW	12	112782999	missense	probably benign	0.01
R6167:Ahnak2	UTSW	12	112783122	missense	probably benign	0.03
R6168:Ahnak2	UTSW	12	112783122	missense	probably benign	0.03
R6405:Ahnak2	UTSW	12	112773337	missense	probably damaging	1.00
R6460:Ahnak2	UTSW	12	112786990	missense	probably null	0.27
R6495:Ahnak2	UTSW	12	112773714	missense	probably damaging	1.00
R6544:Ahnak2	UTSW	12	112780652	unclassified	probably benign
R6656:Ahnak2	UTSW	12	112785371	missense	probably benign	0.02
R6679:Ahnak2	UTSW	12	112772976	missense	probably damaging	1.00
R6723:Ahnak2	UTSW	12	112778793	missense	probably damaging	1.00
R6774:Ahnak2	UTSW	12	112773738	missense	possibly damaging	0.87
R6884:Ahnak2	UTSW	12	112775429	missense	possibly damaging	0.81
R6906:Ahnak2	UTSW	12	112785313	missense	probably benign	0.00
R6919:Ahnak2	UTSW	12	112774684	missense	possibly damaging	0.55
R7036:Ahnak2	UTSW	12	112778781	unclassified	probably benign
R7037:Ahnak2	UTSW	12	112774278	missense	probably damaging	0.99
R7064:Ahnak2	UTSW	12	112780742	unclassified	probably benign
R7072:Ahnak2	UTSW	12	112788166	missense
R7112:Ahnak2	UTSW	12	112783119	missense
R7268:Ahnak2	UTSW	12	112780802	missense
R7269:Ahnak2	UTSW	12	112780802	missense
R7270:Ahnak2	UTSW	12	112780802	missense
R7271:Ahnak2	UTSW	12	112780802	missense
R7444:Ahnak2	UTSW	12	112781208	missense
R7448:Ahnak2	UTSW	12	112782502	missense
R7488:Ahnak2	UTSW	12	112785021	missense
R7508:Ahnak2	UTSW	12	112774405	missense	possibly damaging	0.46
R7560:Ahnak2	UTSW	12	112779674	missense
R7611:Ahnak2	UTSW	12	112788129	missense
R7743:Ahnak2	UTSW	12	112784763	missense	not run
R7762:Ahnak2	UTSW	12	112775680	missense	probably benign	0.27
R7780:Ahnak2	UTSW	12	112782613	missense
R7930:Ahnak2	UTSW	12	112779125	missense
R7985:Ahnak2	UTSW	12	112778963	missense
R8114:Ahnak2	UTSW	12	112774729	missense	probably benign	0.05
R8122:Ahnak2	UTSW	12	112776076	missense	possibly damaging	0.83
R8240:Ahnak2	UTSW	12	112774648	missense	probably benign	0.03
R8289:Ahnak2	UTSW	12	112775808	missense	possibly damaging	0.46
R8315:Ahnak2	UTSW	12	112781133	missense
R8430:Ahnak2	UTSW	12	112774687	missense	possibly damaging	0.86
R8476:Ahnak2	UTSW	12	112782991	unclassified	probably benign
R8712:Ahnak2	UTSW	12	112786252	missense
R8712:Ahnak2	UTSW	12	112787089	missense
R8778:Ahnak2	UTSW	12	112783158	missense
R8830:Ahnak2	UTSW	12	112787036	missense
R9014:Ahnak2	UTSW	12	112773736	missense	possibly damaging	0.95
R9055:Ahnak2	UTSW	12	112774585	missense	possibly damaging	0.90
R9327:Ahnak2	UTSW	12	112784826	missense
R9386:Ahnak2	UTSW	12	112778993	missense
R9445:Ahnak2	UTSW	12	112781355	missense
R9462:Ahnak2	UTSW	12	112787035	missense
R9559:Ahnak2	UTSW	12	112786162	critical splice donor site	probably null
R9571:Ahnak2	UTSW	12	112776076	missense	possibly damaging	0.83
R9589:Ahnak2	UTSW	12	112782728	missense
R9664:Ahnak2	UTSW	12	112774929	missense	probably damaging	0.97
R9711:Ahnak2	UTSW	12	112773034	missense	possibly damaging	0.83
Z1177:Ahnak2	UTSW	12	112781199	missense

Predicted Primers

PCR Primer
(F):5'- CAGTCTCAGACAGAACGTTTTCAG -3'
(R):5'- TCAAGATGCCCAAGGTGGAC -3'

Sequencing Primer
(F):5'- CTCAGACAGAACGTTTTCAGACTCTG -3'
(R):5'- AGGTGGACCTCAAGGGGC -3'

Posted On

2016-06-21