Incidental Mutation 'R5146:Fgfr4'
ID 395126
Institutional Source Beutler Lab
Gene Symbol Fgfr4
Ensembl Gene ENSMUSG00000005320
Gene Name fibroblast growth factor receptor 4
Synonyms Fgfr-4
MMRRC Submission 042730-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5146 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 55300631-55316572 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 55313725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 511 (L511F)
Ref Sequence ENSEMBL: ENSMUSP00000005452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005452]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000005452
AA Change: L511F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005452
Gene: ENSMUSG00000005320
AA Change: L511F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IGc2 45 105 1.39e-11 SMART
IGc2 160 228 3.1e-18 SMART
IGc2 259 337 1.59e-6 SMART
low complexity region 369 387 N/A INTRINSIC
low complexity region 416 446 N/A INTRINSIC
TyrKc 464 740 1.67e-148 SMART
low complexity region 764 795 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are viable, healthy and overtly normal, except for a 10% weight reduction at weaning. Mice doubly homozygous for disruptions of Fgfr3 and Fgfr4 show novel phenotypes not seen in either single mutant, including dwarfismand defective respiratory alveogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,289,799 (GRCm39) D1498G possibly damaging Het
Adcyap1r1 A G 6: 55,461,957 (GRCm39) I329V probably benign Het
Ahnak2 A C 12: 112,742,160 (GRCm39) H637Q probably benign Het
Carmil3 A G 14: 55,734,636 (GRCm39) D455G probably benign Het
Cdh20 A G 1: 109,922,042 (GRCm39) T45A probably damaging Het
Chil4 T A 3: 106,110,150 (GRCm39) T315S probably benign Het
Cntnap5c T C 17: 58,320,842 (GRCm39) V138A probably damaging Het
Csmd1 T C 8: 16,246,204 (GRCm39) D1065G probably damaging Het
Cspp1 C T 1: 10,145,101 (GRCm39) R296* probably null Het
Dnah17 A G 11: 118,005,005 (GRCm39) M793T probably damaging Het
Dock4 A G 12: 40,699,491 (GRCm39) probably null Het
Gm14415 T C 2: 176,796,024 (GRCm39) noncoding transcript Het
Gpam A G 19: 55,082,378 (GRCm39) V91A probably damaging Het
Grin2b T A 6: 135,756,340 (GRCm39) I462F probably damaging Het
Grwd1 A T 7: 45,477,258 (GRCm39) F210I probably damaging Het
H2-T9 A G 17: 36,439,907 (GRCm39) W76R probably damaging Het
Itfg1 T C 8: 86,445,497 (GRCm39) *611W probably null Het
Kcna2 T C 3: 107,012,814 (GRCm39) V465A probably benign Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Myo15b A G 11: 115,782,024 (GRCm39) T1444A probably benign Het
Nlgn3 G A X: 100,361,891 (GRCm39) V287I probably benign Het
Oas1c A G 5: 120,940,159 (GRCm39) S336P probably benign Het
Pirb T C 7: 3,715,620 (GRCm39) probably benign Het
Pot1b A T 17: 55,979,865 (GRCm39) Y330* probably null Het
Rnf20 A T 4: 49,651,456 (GRCm39) M641L probably benign Het
Sppl2b T C 10: 80,703,474 (GRCm39) *579Q probably null Het
Sumf1 G A 6: 108,162,271 (GRCm39) P83S probably benign Het
Tmem101 C T 11: 102,045,450 (GRCm39) R133Q probably benign Het
Ttn G A 2: 76,700,707 (GRCm39) probably benign Het
Vmn2r84 A G 10: 130,221,971 (GRCm39) Y750H probably damaging Het
Zfp873 A G 10: 81,896,058 (GRCm39) Y300C probably damaging Het
Other mutations in Fgfr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Fgfr4 APN 13 55,306,983 (GRCm39) missense probably damaging 0.99
IGL02140:Fgfr4 APN 13 55,308,992 (GRCm39) missense probably benign
IGL02817:Fgfr4 APN 13 55,304,481 (GRCm39) critical splice donor site probably null
interference UTSW 13 55,313,777 (GRCm39) missense probably damaging 1.00
Modest UTSW 13 55,314,064 (GRCm39) missense probably damaging 1.00
offense UTSW 13 55,309,328 (GRCm39) missense possibly damaging 0.81
R0153:Fgfr4 UTSW 13 55,309,198 (GRCm39) splice site probably benign
R0727:Fgfr4 UTSW 13 55,304,041 (GRCm39) splice site probably null
R1646:Fgfr4 UTSW 13 55,313,777 (GRCm39) missense probably damaging 1.00
R1749:Fgfr4 UTSW 13 55,315,605 (GRCm39) splice site probably null
R1993:Fgfr4 UTSW 13 55,313,715 (GRCm39) missense probably damaging 1.00
R2037:Fgfr4 UTSW 13 55,315,702 (GRCm39) missense possibly damaging 0.51
R2152:Fgfr4 UTSW 13 55,314,777 (GRCm39) missense probably damaging 1.00
R2386:Fgfr4 UTSW 13 55,315,714 (GRCm39) missense probably benign 0.36
R3086:Fgfr4 UTSW 13 55,315,205 (GRCm39) splice site probably benign
R3939:Fgfr4 UTSW 13 55,304,307 (GRCm39) missense probably null 0.96
R4255:Fgfr4 UTSW 13 55,314,064 (GRCm39) missense probably damaging 1.00
R4463:Fgfr4 UTSW 13 55,304,280 (GRCm39) missense probably benign 0.02
R4510:Fgfr4 UTSW 13 55,309,328 (GRCm39) missense possibly damaging 0.81
R4511:Fgfr4 UTSW 13 55,309,328 (GRCm39) missense possibly damaging 0.81
R4852:Fgfr4 UTSW 13 55,308,969 (GRCm39) missense possibly damaging 0.68
R4932:Fgfr4 UTSW 13 55,315,983 (GRCm39) missense unknown
R5133:Fgfr4 UTSW 13 55,307,828 (GRCm39) missense probably damaging 1.00
R5380:Fgfr4 UTSW 13 55,315,230 (GRCm39) missense probably damaging 1.00
R5431:Fgfr4 UTSW 13 55,304,464 (GRCm39) missense probably benign
R5927:Fgfr4 UTSW 13 55,314,700 (GRCm39) missense probably damaging 1.00
R6318:Fgfr4 UTSW 13 55,313,921 (GRCm39) missense probably damaging 1.00
R6792:Fgfr4 UTSW 13 55,304,711 (GRCm39) missense possibly damaging 0.65
R7018:Fgfr4 UTSW 13 55,314,013 (GRCm39) missense probably damaging 0.98
R7290:Fgfr4 UTSW 13 55,309,262 (GRCm39) missense probably benign 0.00
R7343:Fgfr4 UTSW 13 55,306,968 (GRCm39) missense probably damaging 1.00
R7808:Fgfr4 UTSW 13 55,308,969 (GRCm39) missense possibly damaging 0.68
R7891:Fgfr4 UTSW 13 55,306,964 (GRCm39) missense probably benign 0.22
R9028:Fgfr4 UTSW 13 55,306,967 (GRCm39) missense probably damaging 1.00
R9144:Fgfr4 UTSW 13 55,315,837 (GRCm39) critical splice acceptor site probably null
R9257:Fgfr4 UTSW 13 55,315,974 (GRCm39) missense unknown
R9399:Fgfr4 UTSW 13 55,304,293 (GRCm39) missense probably damaging 1.00
R9457:Fgfr4 UTSW 13 55,308,940 (GRCm39) missense probably benign
R9553:Fgfr4 UTSW 13 55,309,228 (GRCm39) missense probably damaging 0.99
R9620:Fgfr4 UTSW 13 55,308,994 (GRCm39) missense possibly damaging 0.68
Z1177:Fgfr4 UTSW 13 55,313,742 (GRCm39) missense probably damaging 1.00
Z1177:Fgfr4 UTSW 13 55,309,520 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACGTATTTACAACATTTCCACCC -3'
(R):5'- TCCACAATCACGTACAGGGG -3'

Sequencing Primer
(F):5'- CTAAGATTAGACGTGGGCTCTATCC -3'
(R):5'- ATCACGTACAGGGGCCCTAC -3'
Posted On 2016-06-21