Incidental Mutation 'R5146:Carmil3'
ID 395127
Institutional Source Beutler Lab
Gene Symbol Carmil3
Ensembl Gene ENSMUSG00000022211
Gene Name capping protein regulator and myosin 1 linker 3
Synonyms Lrrc16b
MMRRC Submission 042730-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.275) question?
Stock # R5146 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 55728108-55745729 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55734636 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 455 (D455G)
Ref Sequence ENSEMBL: ENSMUSP00000075587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076236] [ENSMUST00000226757] [ENSMUST00000228877]
AlphaFold Q3UFQ8
Predicted Effect probably benign
Transcript: ENSMUST00000076236
AA Change: D455G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000075587
Gene: ENSMUSG00000022211
AA Change: D455G

DomainStartEndE-ValueType
low complexity region 138 151 N/A INTRINSIC
internal_repeat_1 203 297 7.56e-6 PROSPERO
Blast:LRR 333 362 5e-10 BLAST
Blast:LRR 423 446 1e-5 BLAST
low complexity region 447 462 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
internal_repeat_1 496 593 7.56e-6 PROSPERO
Pfam:CARMIL_C 778 1065 5.3e-76 PFAM
low complexity region 1068 1117 N/A INTRINSIC
low complexity region 1137 1146 N/A INTRINSIC
low complexity region 1204 1216 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226388
Predicted Effect probably benign
Transcript: ENSMUST00000226446
Predicted Effect probably benign
Transcript: ENSMUST00000226757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228760
Predicted Effect probably benign
Transcript: ENSMUST00000228877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228497
Meta Mutation Damage Score 0.1640 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,289,799 (GRCm39) D1498G possibly damaging Het
Adcyap1r1 A G 6: 55,461,957 (GRCm39) I329V probably benign Het
Ahnak2 A C 12: 112,742,160 (GRCm39) H637Q probably benign Het
Cdh20 A G 1: 109,922,042 (GRCm39) T45A probably damaging Het
Chil4 T A 3: 106,110,150 (GRCm39) T315S probably benign Het
Cntnap5c T C 17: 58,320,842 (GRCm39) V138A probably damaging Het
Csmd1 T C 8: 16,246,204 (GRCm39) D1065G probably damaging Het
Cspp1 C T 1: 10,145,101 (GRCm39) R296* probably null Het
Dnah17 A G 11: 118,005,005 (GRCm39) M793T probably damaging Het
Dock4 A G 12: 40,699,491 (GRCm39) probably null Het
Fgfr4 G T 13: 55,313,725 (GRCm39) L511F probably damaging Het
Gm14415 T C 2: 176,796,024 (GRCm39) noncoding transcript Het
Gpam A G 19: 55,082,378 (GRCm39) V91A probably damaging Het
Grin2b T A 6: 135,756,340 (GRCm39) I462F probably damaging Het
Grwd1 A T 7: 45,477,258 (GRCm39) F210I probably damaging Het
H2-T9 A G 17: 36,439,907 (GRCm39) W76R probably damaging Het
Itfg1 T C 8: 86,445,497 (GRCm39) *611W probably null Het
Kcna2 T C 3: 107,012,814 (GRCm39) V465A probably benign Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Myo15b A G 11: 115,782,024 (GRCm39) T1444A probably benign Het
Nlgn3 G A X: 100,361,891 (GRCm39) V287I probably benign Het
Oas1c A G 5: 120,940,159 (GRCm39) S336P probably benign Het
Pirb T C 7: 3,715,620 (GRCm39) probably benign Het
Pot1b A T 17: 55,979,865 (GRCm39) Y330* probably null Het
Rnf20 A T 4: 49,651,456 (GRCm39) M641L probably benign Het
Sppl2b T C 10: 80,703,474 (GRCm39) *579Q probably null Het
Sumf1 G A 6: 108,162,271 (GRCm39) P83S probably benign Het
Tmem101 C T 11: 102,045,450 (GRCm39) R133Q probably benign Het
Ttn G A 2: 76,700,707 (GRCm39) probably benign Het
Vmn2r84 A G 10: 130,221,971 (GRCm39) Y750H probably damaging Het
Zfp873 A G 10: 81,896,058 (GRCm39) Y300C probably damaging Het
Other mutations in Carmil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Carmil3 APN 14 55,735,755 (GRCm39) missense probably damaging 0.99
IGL00498:Carmil3 APN 14 55,739,352 (GRCm39) critical splice donor site probably null
IGL01061:Carmil3 APN 14 55,736,087 (GRCm39) missense possibly damaging 0.67
IGL01452:Carmil3 APN 14 55,733,515 (GRCm39) missense probably damaging 0.99
IGL01606:Carmil3 APN 14 55,731,306 (GRCm39) missense possibly damaging 0.83
IGL01633:Carmil3 APN 14 55,731,684 (GRCm39) missense possibly damaging 0.84
IGL01977:Carmil3 APN 14 55,730,993 (GRCm39) missense probably damaging 1.00
IGL02065:Carmil3 APN 14 55,731,279 (GRCm39) splice site probably benign
IGL02160:Carmil3 APN 14 55,731,015 (GRCm39) missense possibly damaging 0.70
IGL02491:Carmil3 APN 14 55,741,974 (GRCm39) missense probably benign 0.00
IGL02567:Carmil3 APN 14 55,736,339 (GRCm39) missense possibly damaging 0.93
IGL02629:Carmil3 APN 14 55,736,525 (GRCm39) missense probably damaging 0.97
IGL02720:Carmil3 APN 14 55,744,867 (GRCm39) missense probably damaging 0.97
IGL03100:Carmil3 APN 14 55,732,175 (GRCm39) missense probably damaging 0.99
PIT4434001:Carmil3 UTSW 14 55,732,145 (GRCm39) missense probably null 1.00
R0023:Carmil3 UTSW 14 55,730,333 (GRCm39) missense probably damaging 1.00
R0023:Carmil3 UTSW 14 55,730,333 (GRCm39) missense probably damaging 1.00
R0027:Carmil3 UTSW 14 55,731,860 (GRCm39) missense probably damaging 0.96
R0101:Carmil3 UTSW 14 55,735,212 (GRCm39) splice site probably benign
R0321:Carmil3 UTSW 14 55,739,698 (GRCm39) missense possibly damaging 0.63
R0370:Carmil3 UTSW 14 55,732,899 (GRCm39) missense possibly damaging 0.82
R0465:Carmil3 UTSW 14 55,737,318 (GRCm39) missense probably damaging 0.99
R0647:Carmil3 UTSW 14 55,739,892 (GRCm39) critical splice donor site probably null
R1503:Carmil3 UTSW 14 55,735,737 (GRCm39) missense probably damaging 0.96
R1635:Carmil3 UTSW 14 55,733,739 (GRCm39) missense possibly damaging 0.91
R1715:Carmil3 UTSW 14 55,741,989 (GRCm39) missense probably benign 0.02
R1923:Carmil3 UTSW 14 55,739,861 (GRCm39) missense probably damaging 0.99
R1944:Carmil3 UTSW 14 55,736,087 (GRCm39) missense probably damaging 0.97
R2513:Carmil3 UTSW 14 55,741,295 (GRCm39) missense probably damaging 0.98
R2892:Carmil3 UTSW 14 55,735,770 (GRCm39) missense probably damaging 0.96
R3433:Carmil3 UTSW 14 55,745,151 (GRCm39) missense probably benign 0.05
R3552:Carmil3 UTSW 14 55,744,859 (GRCm39) missense possibly damaging 0.86
R3783:Carmil3 UTSW 14 55,734,433 (GRCm39) missense probably damaging 1.00
R3787:Carmil3 UTSW 14 55,734,433 (GRCm39) missense probably damaging 1.00
R4181:Carmil3 UTSW 14 55,741,412 (GRCm39) missense probably benign 0.10
R4285:Carmil3 UTSW 14 55,736,933 (GRCm39) utr 3 prime probably benign
R4420:Carmil3 UTSW 14 55,731,045 (GRCm39) missense probably damaging 0.98
R4424:Carmil3 UTSW 14 55,738,928 (GRCm39) missense probably benign
R4506:Carmil3 UTSW 14 55,736,933 (GRCm39) utr 3 prime probably benign
R4507:Carmil3 UTSW 14 55,736,933 (GRCm39) utr 3 prime probably benign
R4534:Carmil3 UTSW 14 55,736,933 (GRCm39) utr 3 prime probably benign
R4535:Carmil3 UTSW 14 55,736,933 (GRCm39) utr 3 prime probably benign
R4549:Carmil3 UTSW 14 55,743,121 (GRCm39) splice site probably null
R4574:Carmil3 UTSW 14 55,736,933 (GRCm39) utr 3 prime probably benign
R4783:Carmil3 UTSW 14 55,738,778 (GRCm39) critical splice donor site probably null
R4784:Carmil3 UTSW 14 55,738,778 (GRCm39) critical splice donor site probably null
R5279:Carmil3 UTSW 14 55,739,028 (GRCm39) missense probably damaging 0.98
R5425:Carmil3 UTSW 14 55,731,334 (GRCm39) missense probably benign 0.41
R5530:Carmil3 UTSW 14 55,731,081 (GRCm39) missense probably damaging 0.98
R5534:Carmil3 UTSW 14 55,732,347 (GRCm39) missense probably damaging 0.97
R5598:Carmil3 UTSW 14 55,741,456 (GRCm39) frame shift probably null
R5772:Carmil3 UTSW 14 55,730,696 (GRCm39) missense probably damaging 1.00
R5896:Carmil3 UTSW 14 55,741,456 (GRCm39) frame shift probably null
R5931:Carmil3 UTSW 14 55,736,397 (GRCm39) missense probably damaging 0.99
R6048:Carmil3 UTSW 14 55,741,302 (GRCm39) missense probably benign 0.00
R6103:Carmil3 UTSW 14 55,742,884 (GRCm39) missense probably benign 0.02
R6258:Carmil3 UTSW 14 55,737,889 (GRCm39) missense probably damaging 1.00
R6260:Carmil3 UTSW 14 55,737,889 (GRCm39) missense probably damaging 1.00
R6338:Carmil3 UTSW 14 55,737,306 (GRCm39) missense possibly damaging 0.83
R6339:Carmil3 UTSW 14 55,737,306 (GRCm39) missense possibly damaging 0.83
R6646:Carmil3 UTSW 14 55,745,387 (GRCm39) missense probably damaging 0.97
R6936:Carmil3 UTSW 14 55,739,018 (GRCm39) missense probably benign 0.04
R7164:Carmil3 UTSW 14 55,738,739 (GRCm39) missense probably damaging 0.98
R7214:Carmil3 UTSW 14 55,736,069 (GRCm39) missense probably damaging 1.00
R7223:Carmil3 UTSW 14 55,733,695 (GRCm39) missense possibly damaging 0.48
R7269:Carmil3 UTSW 14 55,731,352 (GRCm39) missense probably benign 0.03
R7319:Carmil3 UTSW 14 55,731,817 (GRCm39) missense probably benign 0.13
R7357:Carmil3 UTSW 14 55,728,590 (GRCm39) start gained probably benign
R7386:Carmil3 UTSW 14 55,735,204 (GRCm39) critical splice donor site probably null
R7463:Carmil3 UTSW 14 55,739,853 (GRCm39) missense probably damaging 1.00
R7598:Carmil3 UTSW 14 55,732,278 (GRCm39) missense possibly damaging 0.61
R7602:Carmil3 UTSW 14 55,738,965 (GRCm39) missense probably null 0.00
R7617:Carmil3 UTSW 14 55,735,348 (GRCm39) missense probably benign 0.06
R7985:Carmil3 UTSW 14 55,734,409 (GRCm39) missense probably benign 0.03
R8127:Carmil3 UTSW 14 55,735,701 (GRCm39) missense probably damaging 0.98
R8423:Carmil3 UTSW 14 55,736,522 (GRCm39) missense probably damaging 1.00
R8465:Carmil3 UTSW 14 55,734,305 (GRCm39) missense probably damaging 1.00
R8849:Carmil3 UTSW 14 55,734,627 (GRCm39) missense probably benign 0.01
R8955:Carmil3 UTSW 14 55,733,534 (GRCm39) missense probably damaging 0.98
R9321:Carmil3 UTSW 14 55,741,425 (GRCm39) missense
R9346:Carmil3 UTSW 14 55,732,141 (GRCm39) missense probably damaging 1.00
R9387:Carmil3 UTSW 14 55,731,869 (GRCm39) nonsense probably null
R9578:Carmil3 UTSW 14 55,741,293 (GRCm39) critical splice acceptor site probably null
U24488:Carmil3 UTSW 14 55,734,636 (GRCm39) missense probably benign 0.02
Z1088:Carmil3 UTSW 14 55,739,025 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAATTCTTCAGCAGCGTC -3'
(R):5'- AGAGAGCTATTCCCTGTTTCTGC -3'

Sequencing Primer
(F):5'- TGAGCCATGTCAACCTGTCAG -3'
(R):5'- GCTCTCCACTCTGTGTGTGTG -3'
Posted On 2016-06-21