Incidental Mutation 'R5146:Gm7030'
ID395129
Institutional Source Beutler Lab
Gene Symbol Gm7030
Ensembl Gene ENSMUSG00000092243
Gene Namepredicted gene 7030
Synonyms
MMRRC Submission 042730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5146 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36109719-36129425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36129015 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 76 (W76R)
Ref Sequence ENSEMBL: ENSMUSP00000133734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046131] [ENSMUST00000172968] [ENSMUST00000173128] [ENSMUST00000173322]
Predicted Effect probably damaging
Transcript: ENSMUST00000046131
AA Change: W76R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040558
Gene: ENSMUSG00000092243
AA Change: W76R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MHC_I 26 204 2.3e-81 PFAM
IGc1 220 285 8.12e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172968
AA Change: W76R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133748
Gene: ENSMUSG00000092243
AA Change: W76R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MHC_I 26 204 1.5e-80 PFAM
IGc1 220 285 8.12e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173128
SMART Domains Protein: ENSMUSP00000134339
Gene: ENSMUSG00000092277

DomainStartEndE-ValueType
low complexity region 103 115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173322
AA Change: W76R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133734
Gene: ENSMUSG00000092243
AA Change: W76R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MHC_I 26 204 2.3e-81 PFAM
IGc1 220 285 8.12e-13 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,243,025 D1498G possibly damaging Het
Adcyap1r1 A G 6: 55,484,972 I329V probably benign Het
Ahnak2 A C 12: 112,775,726 H637Q probably benign Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Cdh7 A G 1: 109,994,312 T45A probably damaging Het
Chil4 T A 3: 106,202,834 T315S probably benign Het
Cntnap5c T C 17: 58,013,847 V138A probably damaging Het
Csmd1 T C 8: 16,196,190 D1065G probably damaging Het
Cspp1 C T 1: 10,074,876 R296* probably null Het
Dnah17 A G 11: 118,114,179 M793T probably damaging Het
Dock4 A G 12: 40,649,492 probably null Het
Fgfr4 G T 13: 55,165,912 L511F probably damaging Het
Gm14415 T C 2: 177,104,231 noncoding transcript Het
Gpam A G 19: 55,093,946 V91A probably damaging Het
Grin2b T A 6: 135,779,342 I462F probably damaging Het
Grwd1 A T 7: 45,827,834 F210I probably damaging Het
Itfg1 T C 8: 85,718,868 *611W probably null Het
Kcna2 T C 3: 107,105,498 V465A probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Myo15b A G 11: 115,891,198 T1444A probably benign Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Oas1c A G 5: 120,802,094 S336P probably benign Het
Pirb T C 7: 3,712,621 probably benign Het
Pot1b A T 17: 55,672,865 Y330* probably null Het
Rnf20 A T 4: 49,651,456 M641L probably benign Het
Sppl2b T C 10: 80,867,640 *579Q probably null Het
Sumf1 G A 6: 108,185,310 P83S probably benign Het
Tmem101 C T 11: 102,154,624 R133Q probably benign Het
Ttn G A 2: 76,870,363 probably benign Het
Vmn2r84 A G 10: 130,386,102 Y750H probably damaging Het
Zfp873 A G 10: 82,060,224 Y300C probably damaging Het
Other mutations in Gm7030
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02997:Gm7030 APN 17 36127836 missense possibly damaging 0.81
IGL03154:Gm7030 APN 17 36127875 missense probably benign 0.01
IGL03170:Gm7030 APN 17 36128713 missense probably damaging 1.00
IGL03229:Gm7030 APN 17 36127722 missense probably damaging 1.00
R0401:Gm7030 UTSW 17 36128705 missense probably damaging 0.99
R0666:Gm7030 UTSW 17 36127834 missense possibly damaging 0.56
R1981:Gm7030 UTSW 17 36128722 missense probably damaging 0.99
R1982:Gm7030 UTSW 17 36128722 missense probably damaging 0.99
R3110:Gm7030 UTSW 17 36129146 missense probably damaging 1.00
R3112:Gm7030 UTSW 17 36129146 missense probably damaging 1.00
R4811:Gm7030 UTSW 17 36127776 missense probably damaging 0.97
R5023:Gm7030 UTSW 17 36109415 unclassified probably benign
R5802:Gm7030 UTSW 17 36111287 intron probably benign
R6628:Gm7030 UTSW 17 36129054 missense possibly damaging 0.49
R7123:Gm7030 UTSW 17 36127794 missense possibly damaging 0.82
R7244:Gm7030 UTSW 17 36127604 splice site probably null
R7880:Gm7030 UTSW 17 36127869 missense possibly damaging 0.59
R7963:Gm7030 UTSW 17 36127869 missense possibly damaging 0.59
V1662:Gm7030 UTSW 17 36128931 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCCTTCAGTGAGTTCGTGAG -3'
(R):5'- GAAGCGAGTTGTCCTGTCTC -3'

Sequencing Primer
(F):5'- AGGGGACGTGACCTCTGAC -3'
(R):5'- ATCTCCAGGTCTGCGCAC -3'
Posted On2016-06-21