Incidental Mutation 'R5146:Pot1b'
ID 395130
Institutional Source Beutler Lab
Gene Symbol Pot1b
Ensembl Gene ENSMUSG00000024174
Gene Name protection of telomeres 1B
Synonyms
MMRRC Submission 042730-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5146 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 55652025-55712628 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 55672865 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 330 (Y330*)
Ref Sequence ENSEMBL: ENSMUSP00000084089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086876]
AlphaFold H7BX60
Predicted Effect probably null
Transcript: ENSMUST00000086876
AA Change: Y330*
SMART Domains Protein: ENSMUSP00000084089
Gene: ENSMUSG00000024174
AA Change: Y330*

DomainStartEndE-ValueType
Telo_bind 11 141 1.74e-51 SMART
Pfam:POT1PC 152 299 7.9e-40 PFAM
low complexity region 313 333 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (35/36)
MGI Phenotype PHENOTYPE: Mice homozygous for one null mutation display male infertility with age, male germ cell apoptosis, hyperpigmentation, increased apoptosis in intestinal crypts, and decreased body size. Mice homozygous for a transgenic gene disruption exhibit neonatal lethality with possible stem cell defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,243,025 D1498G possibly damaging Het
Adcyap1r1 A G 6: 55,484,972 I329V probably benign Het
Ahnak2 A C 12: 112,775,726 H637Q probably benign Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Cdh7 A G 1: 109,994,312 T45A probably damaging Het
Chil4 T A 3: 106,202,834 T315S probably benign Het
Cntnap5c T C 17: 58,013,847 V138A probably damaging Het
Csmd1 T C 8: 16,196,190 D1065G probably damaging Het
Cspp1 C T 1: 10,074,876 R296* probably null Het
Dnah17 A G 11: 118,114,179 M793T probably damaging Het
Dock4 A G 12: 40,649,492 probably null Het
Fgfr4 G T 13: 55,165,912 L511F probably damaging Het
Gm14415 T C 2: 177,104,231 noncoding transcript Het
Gm7030 A G 17: 36,129,015 W76R probably damaging Het
Gpam A G 19: 55,093,946 V91A probably damaging Het
Grin2b T A 6: 135,779,342 I462F probably damaging Het
Grwd1 A T 7: 45,827,834 F210I probably damaging Het
Itfg1 T C 8: 85,718,868 *611W probably null Het
Kcna2 T C 3: 107,105,498 V465A probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Myo15b A G 11: 115,891,198 T1444A probably benign Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Oas1c A G 5: 120,802,094 S336P probably benign Het
Pirb T C 7: 3,712,621 probably benign Het
Rnf20 A T 4: 49,651,456 M641L probably benign Het
Sppl2b T C 10: 80,867,640 *579Q probably null Het
Sumf1 G A 6: 108,185,310 P83S probably benign Het
Tmem101 C T 11: 102,154,624 R133Q probably benign Het
Ttn G A 2: 76,870,363 probably benign Het
Vmn2r84 A G 10: 130,386,102 Y750H probably damaging Het
Zfp873 A G 10: 82,060,224 Y300C probably damaging Het
Other mutations in Pot1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Pot1b APN 17 55695160 missense possibly damaging 0.94
IGL01796:Pot1b APN 17 55669750 missense possibly damaging 0.53
IGL01810:Pot1b APN 17 55662521 missense possibly damaging 0.68
IGL02371:Pot1b APN 17 55695092 missense possibly damaging 0.91
IGL02553:Pot1b APN 17 55695024 splice site probably benign
IGL02957:Pot1b APN 17 55700009 missense probably damaging 0.99
IGL02975:Pot1b APN 17 55662454 splice site probably benign
IGL03172:Pot1b APN 17 55695206 missense possibly damaging 0.60
boulder UTSW 17 55672865 nonsense probably null
erosion UTSW 17 55687834 missense probably damaging 0.99
G1Funyon:Pot1b UTSW 17 55687895 missense probably benign
R0020:Pot1b UTSW 17 55653429 missense probably benign 0.03
R0540:Pot1b UTSW 17 55665765 missense probably damaging 0.98
R0607:Pot1b UTSW 17 55665765 missense probably damaging 0.98
R0882:Pot1b UTSW 17 55666400 splice site probably benign
R1164:Pot1b UTSW 17 55674085 missense probably benign 0.18
R1476:Pot1b UTSW 17 55653451 missense possibly damaging 0.73
R1874:Pot1b UTSW 17 55654805 missense probably benign
R1955:Pot1b UTSW 17 55674067 missense possibly damaging 0.73
R1960:Pot1b UTSW 17 55662531 missense probably damaging 0.99
R1961:Pot1b UTSW 17 55662531 missense probably damaging 0.99
R2109:Pot1b UTSW 17 55653413 missense probably benign 0.00
R2895:Pot1b UTSW 17 55687939 missense probably damaging 0.98
R2943:Pot1b UTSW 17 55674058 missense probably benign
R4681:Pot1b UTSW 17 55654831 missense probably benign 0.28
R4763:Pot1b UTSW 17 55695160 missense possibly damaging 0.94
R4821:Pot1b UTSW 17 55672885 missense possibly damaging 0.73
R5079:Pot1b UTSW 17 55669801 missense probably benign 0.18
R5176:Pot1b UTSW 17 55699995 missense probably benign 0.05
R5394:Pot1b UTSW 17 55700063 missense probably benign 0.19
R5752:Pot1b UTSW 17 55687834 missense probably damaging 0.99
R6866:Pot1b UTSW 17 55653474 missense possibly damaging 0.83
R8301:Pot1b UTSW 17 55687895 missense probably benign
R8390:Pot1b UTSW 17 55692739 missense probably benign 0.00
R8750:Pot1b UTSW 17 55666537 missense probably benign
R9042:Pot1b UTSW 17 55699991 critical splice donor site probably null
R9564:Pot1b UTSW 17 55662465 missense possibly damaging 0.92
R9565:Pot1b UTSW 17 55662465 missense possibly damaging 0.92
R9611:Pot1b UTSW 17 55699995 missense probably benign 0.05
R9727:Pot1b UTSW 17 55692795 missense possibly damaging 0.92
RF014:Pot1b UTSW 17 55674106 missense probably benign 0.12
X0062:Pot1b UTSW 17 55695154 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCTCAGAAATATACAGCCAGG -3'
(R):5'- GCTAGGCTTATGTTGAATCTGC -3'

Sequencing Primer
(F):5'- CAGCCAGGTATTTACATGTCAGTGAC -3'
(R):5'- CTGCAAATATATTGGGAGAAAGAGCC -3'
Posted On 2016-06-21