Mutagenetix > Incidental Mutation

Incidental Mutation 'R5146:Pot1b'

395130

Institutional Source

Beutler Lab

Gene Symbol

Pot1b

Ensembl Gene

ENSMUSG00000024174

Gene Name

protection of telomeres 1B

Synonyms

MMRRC Submission

042730-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5146 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55652025-55712628 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 55672865 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 330 (Y330*)

Ref Sequence

ENSEMBL: ENSMUSP00000084089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086876]

AlphaFold

H7BX60

Predicted Effect

probably null
Transcript: ENSMUST00000086876
AA Change: Y330*

SMART Domains

Protein: ENSMUSP00000084089
Gene: ENSMUSG00000024174
AA Change: Y330*

Domain	Start	End	E-Value	Type
Telo_bind	11	141	1.74e-51	SMART
Pfam:POT1PC	152	299	7.9e-40	PFAM
low complexity region	313	333	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

97% (35/36)

MGI Phenotype

PHENOTYPE: Mice homozygous for one null mutation display male infertility with age, male germ cell apoptosis, hyperpigmentation, increased apoptosis in intestinal crypts, and decreased body size. Mice homozygous for a transgenic gene disruption exhibit neonatal lethality with possible stem cell defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	A	G	12: 71,243,025	D1498G	possibly damaging	Het
Adcyap1r1	A	G	6: 55,484,972	I329V	probably benign	Het
Ahnak2	A	C	12: 112,775,726	H637Q	probably benign	Het
Carmil3	A	G	14: 55,497,179	D455G	probably benign	Het
Cdh7	A	G	1: 109,994,312	T45A	probably damaging	Het
Chil4	T	A	3: 106,202,834	T315S	probably benign	Het
Cntnap5c	T	C	17: 58,013,847	V138A	probably damaging	Het
Csmd1	T	C	8: 16,196,190	D1065G	probably damaging	Het
Cspp1	C	T	1: 10,074,876	R296*	probably null	Het
Dnah17	A	G	11: 118,114,179	M793T	probably damaging	Het
Dock4	A	G	12: 40,649,492		probably null	Het
Fgfr4	G	T	13: 55,165,912	L511F	probably damaging	Het
Gm14415	T	C	2: 177,104,231		noncoding transcript	Het
Gm7030	A	G	17: 36,129,015	W76R	probably damaging	Het
Gpam	A	G	19: 55,093,946	V91A	probably damaging	Het
Grin2b	T	A	6: 135,779,342	I462F	probably damaging	Het
Grwd1	A	T	7: 45,827,834	F210I	probably damaging	Het
Itfg1	T	C	8: 85,718,868	*611W	probably null	Het
Kcna2	T	C	3: 107,105,498	V465A	probably benign	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Myo15b	A	G	11: 115,891,198	T1444A	probably benign	Het
Nlgn3	G	A	X: 101,318,285	V287I	probably benign	Het
Oas1c	A	G	5: 120,802,094	S336P	probably benign	Het
Pirb	T	C	7: 3,712,621		probably benign	Het
Rnf20	A	T	4: 49,651,456	M641L	probably benign	Het
Sppl2b	T	C	10: 80,867,640	*579Q	probably null	Het
Sumf1	G	A	6: 108,185,310	P83S	probably benign	Het
Tmem101	C	T	11: 102,154,624	R133Q	probably benign	Het
Ttn	G	A	2: 76,870,363		probably benign	Het
Vmn2r84	A	G	10: 130,386,102	Y750H	probably damaging	Het
Zfp873	A	G	10: 82,060,224	Y300C	probably damaging	Het

Other mutations in Pot1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01484:Pot1b	APN	17	55695160	missense	possibly damaging	0.94
IGL01796:Pot1b	APN	17	55669750	missense	possibly damaging	0.53
IGL01810:Pot1b	APN	17	55662521	missense	possibly damaging	0.68
IGL02371:Pot1b	APN	17	55695092	missense	possibly damaging	0.91
IGL02553:Pot1b	APN	17	55695024	splice site	probably benign
IGL02957:Pot1b	APN	17	55700009	missense	probably damaging	0.99
IGL02975:Pot1b	APN	17	55662454	splice site	probably benign
IGL03172:Pot1b	APN	17	55695206	missense	possibly damaging	0.60
boulder	UTSW	17	55672865	nonsense	probably null
erosion	UTSW	17	55687834	missense	probably damaging	0.99
G1Funyon:Pot1b	UTSW	17	55687895	missense	probably benign
R0020:Pot1b	UTSW	17	55653429	missense	probably benign	0.03
R0540:Pot1b	UTSW	17	55665765	missense	probably damaging	0.98
R0607:Pot1b	UTSW	17	55665765	missense	probably damaging	0.98
R0882:Pot1b	UTSW	17	55666400	splice site	probably benign
R1164:Pot1b	UTSW	17	55674085	missense	probably benign	0.18
R1476:Pot1b	UTSW	17	55653451	missense	possibly damaging	0.73
R1874:Pot1b	UTSW	17	55654805	missense	probably benign
R1955:Pot1b	UTSW	17	55674067	missense	possibly damaging	0.73
R1960:Pot1b	UTSW	17	55662531	missense	probably damaging	0.99
R1961:Pot1b	UTSW	17	55662531	missense	probably damaging	0.99
R2109:Pot1b	UTSW	17	55653413	missense	probably benign	0.00
R2895:Pot1b	UTSW	17	55687939	missense	probably damaging	0.98
R2943:Pot1b	UTSW	17	55674058	missense	probably benign
R4681:Pot1b	UTSW	17	55654831	missense	probably benign	0.28
R4763:Pot1b	UTSW	17	55695160	missense	possibly damaging	0.94
R4821:Pot1b	UTSW	17	55672885	missense	possibly damaging	0.73
R5079:Pot1b	UTSW	17	55669801	missense	probably benign	0.18
R5176:Pot1b	UTSW	17	55699995	missense	probably benign	0.05
R5394:Pot1b	UTSW	17	55700063	missense	probably benign	0.19
R5752:Pot1b	UTSW	17	55687834	missense	probably damaging	0.99
R6866:Pot1b	UTSW	17	55653474	missense	possibly damaging	0.83
R8301:Pot1b	UTSW	17	55687895	missense	probably benign
R8390:Pot1b	UTSW	17	55692739	missense	probably benign	0.00
R8750:Pot1b	UTSW	17	55666537	missense	probably benign
R9042:Pot1b	UTSW	17	55699991	critical splice donor site	probably null
R9564:Pot1b	UTSW	17	55662465	missense	possibly damaging	0.92
R9565:Pot1b	UTSW	17	55662465	missense	possibly damaging	0.92
R9611:Pot1b	UTSW	17	55699995	missense	probably benign	0.05
R9727:Pot1b	UTSW	17	55692795	missense	possibly damaging	0.92
RF014:Pot1b	UTSW	17	55674106	missense	probably benign	0.12
X0062:Pot1b	UTSW	17	55695154	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGCTCAGAAATATACAGCCAGG -3'
(R):5'- GCTAGGCTTATGTTGAATCTGC -3'

Sequencing Primer
(F):5'- CAGCCAGGTATTTACATGTCAGTGAC -3'
(R):5'- CTGCAAATATATTGGGAGAAAGAGCC -3'

Posted On

2016-06-21