Incidental Mutation 'R5146:Nlgn3'
ID395133
Institutional Source Beutler Lab
Gene Symbol Nlgn3
Ensembl Gene ENSMUSG00000031302
Gene Nameneuroligin 3
SynonymsNL3, A230085M13Rik, HNL3
MMRRC Submission 042730-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5146 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location101299168-101325963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101318285 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 287 (V287I)
Ref Sequence ENSEMBL: ENSMUSP00000113863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065858] [ENSMUST00000118111] [ENSMUST00000130555] [ENSMUST00000151528]
Predicted Effect probably benign
Transcript: ENSMUST00000065858
AA Change: V401I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000066304
Gene: ENSMUSG00000031302
AA Change: V401I

DomainStartEndE-ValueType
Pfam:COesterase 16 601 2.3e-194 PFAM
Pfam:Abhydrolase_3 180 342 1.7e-7 PFAM
transmembrane domain 685 707 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113671
Predicted Effect probably benign
Transcript: ENSMUST00000118111
AA Change: V287I

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113863
Gene: ENSMUSG00000031302
AA Change: V287I

DomainStartEndE-ValueType
Pfam:COesterase 3 487 3.6e-161 PFAM
Pfam:Abhydrolase_3 66 232 2.4e-7 PFAM
transmembrane domain 571 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130555
AA Change: V381I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122213
Gene: ENSMUSG00000031302
AA Change: V381I

DomainStartEndE-ValueType
Pfam:COesterase 16 510 4.6e-179 PFAM
Pfam:Abhydrolase_3 160 323 1.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144860
Predicted Effect probably benign
Transcript: ENSMUST00000151528
AA Change: V421I

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123283
Gene: ENSMUSG00000031302
AA Change: V421I

DomainStartEndE-ValueType
Pfam:COesterase 16 621 3.4e-207 PFAM
Pfam:Abhydrolase_3 200 363 1.2e-6 PFAM
transmembrane domain 705 727 N/A INTRINSIC
Meta Mutation Damage Score 0.0991 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. Mutations in this gene may be associated with autism and Asperger syndrome. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice show impaired context and cued conditioning, hyperactivity, altered social behavior, less vocalization, smaller brains, and impaired olfaction. Males carrying a knock-in allele show impaired social interaction, and enhanced spatial learning and inhibitory synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,243,025 D1498G possibly damaging Het
Adcyap1r1 A G 6: 55,484,972 I329V probably benign Het
Ahnak2 A C 12: 112,775,726 H637Q probably benign Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Cdh7 A G 1: 109,994,312 T45A probably damaging Het
Chil4 T A 3: 106,202,834 T315S probably benign Het
Cntnap5c T C 17: 58,013,847 V138A probably damaging Het
Csmd1 T C 8: 16,196,190 D1065G probably damaging Het
Cspp1 C T 1: 10,074,876 R296* probably null Het
Dnah17 A G 11: 118,114,179 M793T probably damaging Het
Dock4 A G 12: 40,649,492 probably null Het
Fgfr4 G T 13: 55,165,912 L511F probably damaging Het
Gm14415 T C 2: 177,104,231 noncoding transcript Het
Gm7030 A G 17: 36,129,015 W76R probably damaging Het
Gpam A G 19: 55,093,946 V91A probably damaging Het
Grin2b T A 6: 135,779,342 I462F probably damaging Het
Grwd1 A T 7: 45,827,834 F210I probably damaging Het
Itfg1 T C 8: 85,718,868 *611W probably null Het
Kcna2 T C 3: 107,105,498 V465A probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Myo15b A G 11: 115,891,198 T1444A probably benign Het
Oas1c A G 5: 120,802,094 S336P probably benign Het
Pirb T C 7: 3,712,621 probably benign Het
Pot1b A T 17: 55,672,865 Y330* probably null Het
Rnf20 A T 4: 49,651,456 M641L probably benign Het
Sppl2b T C 10: 80,867,640 *579Q probably null Het
Sumf1 G A 6: 108,185,310 P83S probably benign Het
Tmem101 C T 11: 102,154,624 R133Q probably benign Het
Ttn G A 2: 76,870,363 probably benign Het
Vmn2r84 A G 10: 130,386,102 Y750H probably damaging Het
Zfp873 A G 10: 82,060,224 Y300C probably damaging Het
Other mutations in Nlgn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Nlgn3 APN X 101320092 missense probably benign 0.28
IGL01327:Nlgn3 APN X 101318622 missense probably benign 0.08
IGL01414:Nlgn3 APN X 101302260 missense probably benign 0.00
R1296:Nlgn3 UTSW X 101308916 splice site probably benign
R1794:Nlgn3 UTSW X 101320033 missense probably benign 0.30
R5144:Nlgn3 UTSW X 101318285 missense probably benign 0.21
R5145:Nlgn3 UTSW X 101318285 missense probably benign 0.21
R8677:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
R8678:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
R8684:Nlgn3 UTSW X 101319819 nonsense probably null
R8696:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
Z1176:Nlgn3 UTSW X 101317982 missense probably benign 0.30
Z1176:Nlgn3 UTSW X 101319877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGCTACCATGTGGCTTTTG -3'
(R):5'- TAGGTAGGTGAGCCATAGCG -3'

Sequencing Primer
(F):5'- CTTTTGGCCCTGTGATTGATG -3'
(R):5'- AGATCGGCTGTCACCACTGAAG -3'
Posted On2016-06-21