Incidental Mutation 'R5147:Mymk'
ID395138
Institutional Source Beutler Lab
Gene Symbol Mymk
Ensembl Gene ENSMUSG00000009214
Gene Namemyomaker, myoblast fusion factor
Synonyms1110002H13Rik, Tmem8c
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location27061636-27072179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27062287 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 148 (M148I)
Ref Sequence ENSEMBL: ENSMUSP00000128491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009358] [ENSMUST00000163967]
Predicted Effect probably benign
Transcript: ENSMUST00000009358
AA Change: M189I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000009358
Gene: ENSMUSG00000009214
AA Change: M189I

DomainStartEndE-ValueType
Pfam:DUF3522 3 185 1.1e-48 PFAM
low complexity region 196 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163967
AA Change: M148I

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128491
Gene: ENSMUSG00000009214
AA Change: M148I

DomainStartEndE-ValueType
Pfam:DUF3522 4 144 9e-41 PFAM
low complexity region 155 169 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit early postnatal lethality, paralysis, kyphosis and defective myoblast fusion and survival leading to the absence of differentiated muscle in the trunk, limb and head. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vgll4 A G 6: 114,890,615 probably null Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Mymk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mymk APN 2 27062787 missense probably damaging 1.00
IGL01947:Mymk APN 2 27066394 missense possibly damaging 0.93
R0173:Mymk UTSW 2 27062250 missense probably damaging 1.00
R0322:Mymk UTSW 2 27067406 missense probably damaging 1.00
R1686:Mymk UTSW 2 27062334 missense probably damaging 1.00
R4583:Mymk UTSW 2 27062280 missense probably benign 0.01
R4610:Mymk UTSW 2 27062707 missense probably damaging 1.00
R5220:Mymk UTSW 2 27062214 missense probably benign 0.00
R5237:Mymk UTSW 2 27062188 makesense probably null
R6189:Mymk UTSW 2 27067365 missense possibly damaging 0.53
R6610:Mymk UTSW 2 27067393 missense possibly damaging 0.94
R7257:Mymk UTSW 2 27067368 missense probably damaging 0.99
R7870:Mymk UTSW 2 27062286 missense probably damaging 0.96
R8507:Mymk UTSW 2 27062700 critical splice donor site probably null
R8784:Mymk UTSW 2 27071935 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGTACCTTGGGAGAGACAGC -3'
(R):5'- ACCCAAGATGCACGCATGTC -3'

Sequencing Primer
(F):5'- CCTTGGGAGAGACAGCAGGAC -3'
(R):5'- ATGCACGCATGTCCTGGAAG -3'
Posted On2016-06-21