Incidental Mutation 'R5147:Lrit3'
ID395142
Institutional Source Beutler Lab
Gene Symbol Lrit3
Ensembl Gene ENSMUSG00000093865
Gene Nameleucine-rich repeat, immunoglobulin-like and transmembrane domains 3
SynonymsLOC242235
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location129787881-129804030 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129803925 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 36 (S36P)
Ref Sequence ENSEMBL: ENSMUSP00000136912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029648] [ENSMUST00000171313] [ENSMUST00000179187] [ENSMUST00000185462] [ENSMUST00000196902] [ENSMUST00000200079]
Predicted Effect probably benign
Transcript: ENSMUST00000029648
SMART Domains Protein: ENSMUSP00000029648
Gene: ENSMUSG00000028012

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 1.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171313
SMART Domains Protein: ENSMUSP00000132360
Gene: ENSMUSG00000028012

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 4.6e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179187
AA Change: S36P

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136912
Gene: ENSMUSG00000093865
AA Change: S36P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 20 61 2.7e-1 SMART
LRR 80 103 6.96e0 SMART
LRR 104 127 3.27e1 SMART
LRR_TYP 128 151 4.47e-3 SMART
LRR_TYP 152 175 7.37e-4 SMART
LRRCT 201 252 4.65e-2 SMART
Blast:IG 260 297 9e-13 BLAST
low complexity region 298 311 N/A INTRINSIC
FN3 364 443 1.85e0 SMART
transmembrane domain 462 484 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000185462
AA Change: S36P

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140184
Gene: ENSMUSG00000093865
AA Change: S36P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 20 61 1.3e-3 SMART
LRR 80 103 2.9e-2 SMART
LRR 104 127 1.4e-1 SMART
LRR_TYP 128 151 1.9e-5 SMART
LRR_TYP 152 175 3.2e-6 SMART
LRRCT 201 252 2.3e-4 SMART
IGc2 266 335 4.7e-11 SMART
low complexity region 340 352 N/A INTRINSIC
low complexity region 362 376 N/A INTRINSIC
low complexity region 408 432 N/A INTRINSIC
FN3 485 564 9e-3 SMART
transmembrane domain 583 605 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196317
Predicted Effect probably benign
Transcript: ENSMUST00000196902
SMART Domains Protein: ENSMUSP00000143093
Gene: ENSMUSG00000028012

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 1.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197535
Predicted Effect probably benign
Transcript: ENSMUST00000200079
SMART Domains Protein: ENSMUSP00000143054
Gene: ENSMUSG00000028012

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7tm_1 30 197 3.1e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a fibronectin type III domain and a C-terminal transmembrane domain, as well as a leucine-rich repeat domain and immunoglobulin-like domain near the N-terminus. The encoded protein may regulate fibroblast growth factor receptors and affect the modification of these receptors, which are glycosylated differently in the Golgi and endoplasmic reticulum. Mutations in this gene are associated with congenital stationary night blindness, type 1F. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele show a selective absence of the ERG b-wave with a normal a-wave component under scotopic conditions, as well as variable ERG responses with larger a-wave amplitudes, shorter b-wave amplitudes, and longer implicit times of both waves under photopic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vgll4 A G 6: 114,890,615 probably null Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Lrit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Lrit3 UTSW 3 129788819 small insertion probably benign
FR4340:Lrit3 UTSW 3 129788808 small insertion probably benign
FR4548:Lrit3 UTSW 3 129788813 small insertion probably benign
FR4548:Lrit3 UTSW 3 129788816 small insertion probably benign
FR4589:Lrit3 UTSW 3 129803913 frame shift probably null
FR4737:Lrit3 UTSW 3 129788806 small insertion probably benign
FR4737:Lrit3 UTSW 3 129788810 small insertion probably benign
FR4737:Lrit3 UTSW 3 129803913 frame shift probably null
FR4976:Lrit3 UTSW 3 129803910 unclassified probably benign
R0555:Lrit3 UTSW 3 129791296 missense probably damaging 1.00
R0629:Lrit3 UTSW 3 129788302 missense probably damaging 1.00
R0631:Lrit3 UTSW 3 129788555 missense probably damaging 1.00
R1690:Lrit3 UTSW 3 129800745 missense probably damaging 0.99
R1902:Lrit3 UTSW 3 129791246 missense probably benign 0.17
R1955:Lrit3 UTSW 3 129800481 missense probably benign 0.11
R3155:Lrit3 UTSW 3 129791395 missense probably benign 0.00
R4005:Lrit3 UTSW 3 129791372 missense probably benign 0.14
R4445:Lrit3 UTSW 3 129788531 nonsense probably null
R4675:Lrit3 UTSW 3 129788472 missense probably damaging 1.00
R5104:Lrit3 UTSW 3 129788391 missense possibly damaging 0.86
R5271:Lrit3 UTSW 3 129788301 missense probably damaging 1.00
R5505:Lrit3 UTSW 3 129791438 missense possibly damaging 0.83
R5587:Lrit3 UTSW 3 129788898 missense probably benign 0.25
R6056:Lrit3 UTSW 3 129789355 missense probably damaging 1.00
R6239:Lrit3 UTSW 3 129800346 missense probably damaging 0.98
R6280:Lrit3 UTSW 3 129788763 missense probably damaging 0.99
R6305:Lrit3 UTSW 3 129800460 missense probably damaging 0.98
R6441:Lrit3 UTSW 3 129800360 missense probably benign
R6947:Lrit3 UTSW 3 129789234 missense probably benign 0.01
R6949:Lrit3 UTSW 3 129789285 missense probably damaging 1.00
R7850:Lrit3 UTSW 3 129800803 missense probably damaging 1.00
R7933:Lrit3 UTSW 3 129800803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGAAACCCGTGTGAGG -3'
(R):5'- ATTCGTGGTAGCTTCCCCATG -3'

Sequencing Primer
(F):5'- AAACCCGTGTGAGGCTTCTGAG -3'
(R):5'- GTGGTAGCTTCCCCATGTTCTTG -3'
Posted On2016-06-21