Incidental Mutation 'R5147:Cgref1'
ID395146
Institutional Source Beutler Lab
Gene Symbol Cgref1
Ensembl Gene ENSMUSG00000029161
Gene Namecell growth regulator with EF hand domain 1
SynonymsCGR11, 1110004G24Rik
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location30933143-30945591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30933705 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 255 (G255E)
Ref Sequence ENSEMBL: ENSMUSP00000031051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031051] [ENSMUST00000031053] [ENSMUST00000201571] [ENSMUST00000201621] [ENSMUST00000202752]
Predicted Effect probably benign
Transcript: ENSMUST00000031051
AA Change: G255E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000031051
Gene: ENSMUSG00000029161
AA Change: G255E

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 28 44 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
SCOP:d2pvba_ 113 188 1e-4 SMART
Blast:EFh 120 148 1e-9 BLAST
Blast:EFh 164 189 4e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000031053
SMART Domains Protein: ENSMUSP00000031053
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 293 5.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200978
Predicted Effect probably benign
Transcript: ENSMUST00000201571
SMART Domains Protein: ENSMUSP00000144226
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 70 2.4e-5 PFAM
Pfam:PfkB 65 249 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201621
SMART Domains Protein: ENSMUSP00000144050
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 294 1.5e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202627
Predicted Effect probably benign
Transcript: ENSMUST00000202752
SMART Domains Protein: ENSMUSP00000143850
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 243 5.8e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vgll4 A G 6: 114,890,615 probably null Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Cgref1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02541:Cgref1 APN 5 30934158 critical splice donor site probably null
IGL02572:Cgref1 APN 5 30933567 missense probably benign
IGL03036:Cgref1 APN 5 30933593 missense probably damaging 0.96
FR4304:Cgref1 UTSW 5 30933780 unclassified probably benign
FR4449:Cgref1 UTSW 5 30933776 unclassified probably benign
FR4449:Cgref1 UTSW 5 30933778 nonsense probably null
R1340:Cgref1 UTSW 5 30945346 splice site probably benign
R1463:Cgref1 UTSW 5 30935994 unclassified probably benign
R1551:Cgref1 UTSW 5 30933585 missense probably benign 0.03
R2059:Cgref1 UTSW 5 30933645 missense possibly damaging 0.95
R6059:Cgref1 UTSW 5 30945384 missense probably damaging 0.99
R7501:Cgref1 UTSW 5 30945456 missense probably damaging 0.99
R7542:Cgref1 UTSW 5 30933593 missense probably damaging 0.96
R8137:Cgref1 UTSW 5 30934405 missense possibly damaging 0.93
RF064:Cgref1 UTSW 5 30933774 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCCTCAGCCTCATTTGG -3'
(R):5'- TGCAGAGCTCATCAACTTCC -3'

Sequencing Primer
(F):5'- CCTCAGCCTCATTTGGAGTGTTTAG -3'
(R):5'- GAGCTCATCAACTTCCCAGAAG -3'
Posted On2016-06-21