Incidental Mutation 'R5147:Hpse'
ID395147
Institutional Source Beutler Lab
Gene Symbol Hpse
Ensembl Gene ENSMUSG00000035273
Gene Nameheparanase
SynonymsHpa
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location100679484-100719716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100719509 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 29 (D29G)
Ref Sequence ENSEMBL: ENSMUSP00000044072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045617] [ENSMUST00000112908]
Predicted Effect probably benign
Transcript: ENSMUST00000045617
AA Change: D29G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000044072
Gene: ENSMUSG00000035273
AA Change: D29G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Glyco_hydro_79n 132 362 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112908
AA Change: D29G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108529
Gene: ENSMUSG00000035273
AA Change: D29G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Glyco_hydro_79n 144 362 1.2e-24 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an endoglucuronidase enzyme that plays an important role in tumor invasion and metastasis. The encoded preproprotein undergoes proteolytic processing to generate an active heterodimeric enzyme that cleaves the heparan sulfate proteoglycans associated with the cell surface and extracellular matrix. Mice lacking the encoded protein do not show any prominent pathological alterations under normal conditions but fail to develop albuminuria and renal damage in response to drug-induced diabetes. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit precocious mammry gland development, increased angiogenesis and increased neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vgll4 A G 6: 114,890,615 probably null Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Hpse
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Hpse APN 5 100691330 missense possibly damaging 0.89
IGL00743:Hpse APN 5 100698999 missense probably benign 0.01
IGL02377:Hpse APN 5 100691333 missense probably damaging 1.00
R0082:Hpse UTSW 5 100692262 missense possibly damaging 0.93
R0194:Hpse UTSW 5 100719512 missense probably benign
R1974:Hpse UTSW 5 100692238 missense probably damaging 1.00
R2065:Hpse UTSW 5 100698931 missense probably damaging 1.00
R2152:Hpse UTSW 5 100691403 nonsense probably null
R2405:Hpse UTSW 5 100708771 missense possibly damaging 0.78
R3791:Hpse UTSW 5 100692238 missense probably damaging 1.00
R5127:Hpse UTSW 5 100719537 missense unknown
R5385:Hpse UTSW 5 100708724 nonsense probably null
R6446:Hpse UTSW 5 100695569 nonsense probably null
R7009:Hpse UTSW 5 100692279 missense probably benign 0.01
R7186:Hpse UTSW 5 100695529 missense probably damaging 1.00
R7681:Hpse UTSW 5 100691391 missense possibly damaging 0.94
R7964:Hpse UTSW 5 100698911 critical splice donor site probably null
R8064:Hpse UTSW 5 100688900 missense probably benign 0.00
R8183:Hpse UTSW 5 100685118 missense probably damaging 1.00
R8268:Hpse UTSW 5 100699041 missense probably damaging 1.00
R8830:Hpse UTSW 5 100695586 missense probably benign 0.12
R8845:Hpse UTSW 5 100711382 missense probably benign
X0022:Hpse UTSW 5 100691378 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCGAGTGTGATTGGACAG -3'
(R):5'- ATTTCAAAAGTGGACGTGACC -3'

Sequencing Primer
(F):5'- TGTGATTGGACAGGCGAGG -3'
(R):5'- AGGGTACTGAGTCCTGGC -3'
Posted On2016-06-21