Incidental Mutation 'R5147:Vgll4'
ID395151
Institutional Source Beutler Lab
Gene Symbol Vgll4
Ensembl Gene ENSMUSG00000030315
Gene Namevestigial like family member 4
SynonymsVGL-4
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location114860628-114969994 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 114890615 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032459] [ENSMUST00000139640] [ENSMUST00000147639]
Predicted Effect probably null
Transcript: ENSMUST00000032459
SMART Domains Protein: ENSMUSP00000032459
Gene: ENSMUSG00000030315

DomainStartEndE-ValueType
TDU 203 218 5.27e-4 SMART
TDU 231 246 9.84e-4 SMART
low complexity region 251 264 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139640
SMART Domains Protein: ENSMUSP00000118618
Gene: ENSMUSG00000030315

DomainStartEndE-ValueType
Pfam:VGLL4 4 189 1.1e-67 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147639
SMART Domains Protein: ENSMUSP00000123139
Gene: ENSMUSG00000030315

DomainStartEndE-ValueType
TDU 197 212 5.27e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Vgll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01454:Vgll4 APN 6 114863996 missense probably benign 0.10
IGL02080:Vgll4 APN 6 114862798 missense probably damaging 1.00
IGL02551:Vgll4 APN 6 114862293 missense probably damaging 1.00
R0946:Vgll4 UTSW 6 114890807 critical splice acceptor site probably null
R0946:Vgll4 UTSW 6 114890808 critical splice acceptor site probably null
R1710:Vgll4 UTSW 6 114957934 critical splice donor site probably null
R1815:Vgll4 UTSW 6 114864059 missense probably benign 0.05
R1843:Vgll4 UTSW 6 114862795 missense probably benign 0.22
R1922:Vgll4 UTSW 6 114921335 missense probably benign 0.29
R4407:Vgll4 UTSW 6 114890612 splice site probably null
R5714:Vgll4 UTSW 6 114890776 missense possibly damaging 0.70
R6080:Vgll4 UTSW 6 114921338 missense probably benign 0.29
R6954:Vgll4 UTSW 6 114921367 missense probably damaging 1.00
R7445:Vgll4 UTSW 6 114862196 missense unknown
R7500:Vgll4 UTSW 6 114862332 missense probably damaging 1.00
R8207:Vgll4 UTSW 6 114862825 missense probably damaging 1.00
R8252:Vgll4 UTSW 6 114890734 missense probably damaging 1.00
R8305:Vgll4 UTSW 6 114890652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACCAGTCACTAAAGTCAG -3'
(R):5'- GCCCGACTGCTGATAACATC -3'

Sequencing Primer
(F):5'- GCTCGACACCTTCCTGTCATATAAAC -3'
(R):5'- TGCATAGGTGAAGCTTCCCTCAG -3'
Posted On2016-06-21