Incidental Mutation 'R5147:Nlrp12'
ID395152
Institutional Source Beutler Lab
Gene Symbol Nlrp12
Ensembl Gene ENSMUSG00000078817
Gene NameNLR family, pyrin domain containing 12
SynonymsNalp12
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location3218784-3249740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3241373 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 170 (I170F)
Ref Sequence ENSEMBL: ENSMUSP00000104293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108653]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108653
AA Change: I170F

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104293
Gene: ENSMUSG00000078817
AA Change: I170F

DomainStartEndE-ValueType
PYRIN 9 91 1.84e-24 SMART
FISNA 128 201 1.71e-24 SMART
Pfam:NACHT 211 381 4.2e-52 PFAM
LRR 705 732 6.78e-3 SMART
LRR 734 761 2.13e1 SMART
LRR 762 789 3.49e-5 SMART
LRR 791 818 7.02e0 SMART
LRR 819 846 6.52e-5 SMART
LRR 848 875 6.92e-1 SMART
LRR 876 903 2.47e-5 SMART
LRR 905 932 3.78e0 SMART
LRR 933 960 1.63e-5 SMART
LRR 962 989 4.9e0 SMART
LRR 990 1017 1.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205233
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele have defects in dendritic and myeloid cell migration and a decreased susceptibility to type IV hypersensitivity reactions. Mice homozygous for a second null allele display increased susceptibility to induced colitis and to chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vgll4 A G 6: 114,890,615 probably null Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Nlrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Nlrp12 APN 7 3240757 missense probably damaging 1.00
IGL01301:Nlrp12 APN 7 3240092 missense probably damaging 1.00
IGL01346:Nlrp12 APN 7 3240686 missense probably damaging 1.00
IGL01482:Nlrp12 APN 7 3235160 missense possibly damaging 0.65
IGL01534:Nlrp12 APN 7 3239833 missense probably benign 0.03
IGL02106:Nlrp12 APN 7 3233944 missense probably benign 0.02
IGL02159:Nlrp12 APN 7 3249545 utr 5 prime probably benign
IGL02184:Nlrp12 APN 7 3240464 missense probably damaging 0.99
IGL02221:Nlrp12 APN 7 3240967 missense possibly damaging 0.89
IGL02252:Nlrp12 APN 7 3245350 missense probably benign 0.01
ANU18:Nlrp12 UTSW 7 3240092 missense probably damaging 1.00
PIT4280001:Nlrp12 UTSW 7 3241433 missense possibly damaging 0.94
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0090:Nlrp12 UTSW 7 3240034 missense probably damaging 0.99
R0446:Nlrp12 UTSW 7 3234029 missense probably benign 0.00
R0503:Nlrp12 UTSW 7 3249377 missense probably damaging 0.97
R0538:Nlrp12 UTSW 7 3249262 missense possibly damaging 0.56
R1114:Nlrp12 UTSW 7 3228534 missense probably benign
R1680:Nlrp12 UTSW 7 3241174 missense probably damaging 1.00
R2030:Nlrp12 UTSW 7 3228417 missense probably damaging 1.00
R2096:Nlrp12 UTSW 7 3233195 missense probably benign 0.05
R2118:Nlrp12 UTSW 7 3241449 missense probably damaging 1.00
R2266:Nlrp12 UTSW 7 3233945 missense probably benign 0.00
R3615:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R3616:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R4375:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4376:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4379:Nlrp12 UTSW 7 3239924 missense probably benign 0.08
R4837:Nlrp12 UTSW 7 3231061 missense probably damaging 1.00
R4856:Nlrp12 UTSW 7 3240442 missense probably damaging 1.00
R4970:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5112:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5505:Nlrp12 UTSW 7 3249385 missense probably damaging 0.99
R5636:Nlrp12 UTSW 7 3225294 missense probably damaging 0.99
R5891:Nlrp12 UTSW 7 3219259 utr 3 prime probably benign
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6365:Nlrp12 UTSW 7 3239888 missense probably benign 0.00
R6383:Nlrp12 UTSW 7 3234043 missense probably damaging 1.00
R6796:Nlrp12 UTSW 7 3241409 missense probably damaging 1.00
R6886:Nlrp12 UTSW 7 3240683 missense probably benign 0.03
R6957:Nlrp12 UTSW 7 3222486 missense probably damaging 1.00
R6995:Nlrp12 UTSW 7 3239851 missense probably benign
R7340:Nlrp12 UTSW 7 3233125 missense possibly damaging 0.93
R7346:Nlrp12 UTSW 7 3249257 missense probably damaging 0.96
R7387:Nlrp12 UTSW 7 3241201 missense probably damaging 0.97
R7414:Nlrp12 UTSW 7 3241347 missense probably benign 0.01
R7432:Nlrp12 UTSW 7 3222539 missense probably benign 0.14
R7729:Nlrp12 UTSW 7 3228388 critical splice donor site probably null
R7793:Nlrp12 UTSW 7 3245400 missense probably benign
R8257:Nlrp12 UTSW 7 3249332 missense probably damaging 1.00
R8357:Nlrp12 UTSW 7 3240805 missense probably damaging 1.00
R8457:Nlrp12 UTSW 7 3240805 missense probably damaging 1.00
R8558:Nlrp12 UTSW 7 3249481 missense probably damaging 1.00
R8826:Nlrp12 UTSW 7 3240991 missense possibly damaging 0.79
X0064:Nlrp12 UTSW 7 3241386 missense probably benign 0.14
X0065:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
Z1088:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Z1176:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Z1177:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAATCAAACCGGCCTTGGAAG -3'
(R):5'- CACTAATGGCTATGTCACTGATCTTTC -3'

Sequencing Primer
(F):5'- AACATCACTTTGTGGGCCAG -3'
(R):5'- TCTTTCTACTAGATCTACAGACAACC -3'
Posted On2016-06-21