Incidental Mutation 'R5147:Vmn1r65'
ID395153
Institutional Source Beutler Lab
Gene Symbol Vmn1r65
Ensembl Gene ENSMUSG00000066850
Gene Namevomeronasal 1 receptor 65
SynonymsV3R6, V1rd6
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location6007750-6011010 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 6008819 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 139 (I139L)
Ref Sequence ENSEMBL: ENSMUSP00000083520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086338]
Predicted Effect probably benign
Transcript: ENSMUST00000086338
AA Change: I139L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000083520
Gene: ENSMUSG00000066850
AA Change: I139L

DomainStartEndE-ValueType
Pfam:TAS2R 20 308 7.3e-14 PFAM
Pfam:7tm_1 42 301 1.6e-6 PFAM
Pfam:V1R 53 308 5.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227656
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vgll4 A G 6: 114,890,615 probably null Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Vmn1r65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Vmn1r65 APN 7 6008721 missense probably benign 0.12
IGL02821:Vmn1r65 APN 7 6008894 missense possibly damaging 0.62
R0991:Vmn1r65 UTSW 7 6009077 missense probably damaging 0.99
R1457:Vmn1r65 UTSW 7 6009157 missense probably benign 0.10
R1507:Vmn1r65 UTSW 7 6009109 missense probably benign 0.13
R1856:Vmn1r65 UTSW 7 6008266 missense possibly damaging 0.93
R2914:Vmn1r65 UTSW 7 6009041 missense possibly damaging 0.69
R5279:Vmn1r65 UTSW 7 6008755 missense probably damaging 1.00
R5399:Vmn1r65 UTSW 7 6008810 nonsense probably null
R5409:Vmn1r65 UTSW 7 6009013 missense possibly damaging 0.77
R5646:Vmn1r65 UTSW 7 6009224 missense probably benign 0.01
R5963:Vmn1r65 UTSW 7 6008609 missense probably damaging 1.00
R6034:Vmn1r65 UTSW 7 6008869 missense probably damaging 1.00
R6034:Vmn1r65 UTSW 7 6008869 missense probably damaging 1.00
R6327:Vmn1r65 UTSW 7 6008652 missense possibly damaging 0.48
R7958:Vmn1r65 UTSW 7 6008255 missense probably benign 0.01
R8121:Vmn1r65 UTSW 7 6008465 missense possibly damaging 0.87
R8345:Vmn1r65 UTSW 7 6008257 missense probably benign
R8725:Vmn1r65 UTSW 7 6008504 missense probably damaging 1.00
R8727:Vmn1r65 UTSW 7 6008504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTAAGAAGCTCATGCCAAC -3'
(R):5'- AAACTTAGCTGTGGCCAATACC -3'

Sequencing Primer
(F):5'- TGCCAACATTGAAACCAGAAGTTG -3'
(R):5'- AGCTGTGGCCAATACCTTCATTC -3'
Posted On2016-06-21