Incidental Mutation 'R5147:Ilk'
ID395156
Institutional Source Beutler Lab
Gene Symbol Ilk
Ensembl Gene ENSMUSG00000030890
Gene Nameintegrin linked kinase
SynonymsESTM24
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105736592-105742925 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105742567 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 422 (C422R)
Ref Sequence ENSEMBL: ENSMUSP00000130341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033182] [ENSMUST00000033184] [ENSMUST00000136687] [ENSMUST00000141116] [ENSMUST00000149695] [ENSMUST00000163389]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033182
AA Change: C422R

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033182
Gene: ENSMUSG00000030890
AA Change: C422R

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase 193 445 1.5e-25 PFAM
Pfam:Pkinase_Tyr 193 446 7.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033184
SMART Domains Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pro-kuma_activ 32 176 4.53e-50 SMART
low complexity region 177 189 N/A INTRINSIC
Pfam:Peptidase_S8 251 492 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054556
Predicted Effect probably benign
Transcript: ENSMUST00000127298
Predicted Effect probably benign
Transcript: ENSMUST00000130565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131683
Predicted Effect probably benign
Transcript: ENSMUST00000136687
SMART Domains Protein: ENSMUSP00000123443
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141116
SMART Domains Protein: ENSMUSP00000118105
Gene: ENSMUSG00000043866

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 45 91 N/A INTRINSIC
Pfam:TFIID_30kDa 128 177 6.1e-30 PFAM
low complexity region 181 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148971
Predicted Effect probably benign
Transcript: ENSMUST00000149695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152508
Predicted Effect probably benign
Transcript: ENSMUST00000153557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154626
Predicted Effect possibly damaging
Transcript: ENSMUST00000163389
AA Change: C422R

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130341
Gene: ENSMUSG00000030890
AA Change: C422R

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase_Tyr 193 446 4e-39 PFAM
Pfam:Pkinase 195 445 3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210840
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a kinase-like domain and four ankyrin-like repeats. The encoded protein associates at the cell membrane with the cytoplasmic domain of beta integrins, where it regulates integrin-mediated signal transduction. Activity of this protein is important in the epithelial to mesenchymal transition, and over-expression of this gene is implicated in tumor growth and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Nullizygous embryos do not polarize the epiblast and die after implantation. Mice with mutations in the ATP-binding site show aphagia, hunched posture, and neonatal death due to renal aplasia. Mice with mutations in the paxillin-binding site show vasculogenesis and growth defects, and die at ~E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vgll4 A G 6: 114,890,615 probably null Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Ilk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Ilk APN 7 105741169 missense probably benign 0.45
IGL02326:Ilk APN 7 105741633 missense probably damaging 1.00
IGL02969:Ilk APN 7 105740340 missense possibly damaging 0.71
IGL03115:Ilk APN 7 105740335 missense probably damaging 0.99
R3408:Ilk UTSW 7 105740974 missense probably benign
R3792:Ilk UTSW 7 105742087 nonsense probably null
R4879:Ilk UTSW 7 105741804 missense probably benign 0.00
R5011:Ilk UTSW 7 105742249 missense probably damaging 1.00
R5013:Ilk UTSW 7 105742249 missense probably damaging 1.00
R5689:Ilk UTSW 7 105741650 missense probably benign
R5837:Ilk UTSW 7 105741171 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACAAGCACTGTGGTAAGCGC -3'
(R):5'- ACTGGGGTAGTACCATGATTAGAG -3'

Sequencing Primer
(F):5'- GGTAAGCGCTTCCAGCAGTTTATAC -3'
(R):5'- GAGGCAACCAGAGGTCTTTAACTTTG -3'
Posted On2016-06-21