Incidental Mutation 'R5147:Qprt'
ID395157
Institutional Source Beutler Lab
Gene Symbol Qprt
Ensembl Gene ENSMUSG00000030674
Gene Namequinolinate phosphoribosyltransferase
Synonymsnicotinate-nucleotide pyrophosphorylase, 2410027J01Rik, QPRTase
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127107114-127122226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127108450 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 189 (R189W)
Ref Sequence ENSEMBL: ENSMUSP00000032912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032912]
Predicted Effect probably damaging
Transcript: ENSMUST00000032912
AA Change: R189W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032912
Gene: ENSMUSG00000030674
AA Change: R189W

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:QRPTase_N 27 112 5.5e-24 PFAM
Pfam:QRPTase_C 114 284 1.3e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129332
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a key enzyme in catabolism of quinolinate, an intermediate in the tryptophan-nicotinamide adenine dinucleotide pathway. Quinolinate acts as a most potent endogenous exitotoxin to neurons. Elevation of quinolinate levels in the brain has been linked to the pathogenesis of neurodegenerative disorders such as epilepsy, Alzheimer's disease, and Huntington's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vgll4 A G 6: 114,890,615 probably null Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Qprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02089:Qprt APN 7 127108356 missense probably damaging 0.97
IGL02552:Qprt APN 7 127108855 missense probably damaging 1.00
R0082:Qprt UTSW 7 127108186 missense probably damaging 1.00
R0116:Qprt UTSW 7 127109097 missense probably damaging 1.00
R0173:Qprt UTSW 7 127108371 missense probably damaging 1.00
R0615:Qprt UTSW 7 127109076 missense probably damaging 0.96
R1703:Qprt UTSW 7 127108171 missense probably benign 0.34
R2402:Qprt UTSW 7 127108360 missense probably benign 0.01
R5752:Qprt UTSW 7 127109244 missense probably benign 0.00
R6337:Qprt UTSW 7 127108929 missense probably damaging 1.00
R7112:Qprt UTSW 7 127108189 missense probably damaging 1.00
R7136:Qprt UTSW 7 127108812 missense probably damaging 1.00
R8017:Qprt UTSW 7 127108824 missense probably damaging 1.00
R8019:Qprt UTSW 7 127108824 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCCAACATTGCCCATTG -3'
(R):5'- GAGCCTCTGTTCTCACTGTG -3'

Sequencing Primer
(F):5'- GGCCCTGCCCAGAAGTTG -3'
(R):5'- TCCACTGACAGGCATTTCAG -3'
Posted On2016-06-21