Incidental Mutation 'R5147:Ccdc151'
ID395159
Institutional Source Beutler Lab
Gene Symbol Ccdc151
Ensembl Gene ENSMUSG00000039632
Gene Namecoiled-coil domain containing 151
Synonyms
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21989871-22002634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21994862 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 260 (E260G)
Ref Sequence ENSEMBL: ENSMUSP00000041117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044926] [ENSMUST00000115336]
Predicted Effect probably benign
Transcript: ENSMUST00000044926
AA Change: E260G

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000041117
Gene: ENSMUSG00000039632
AA Change: E260G

DomainStartEndE-ValueType
coiled coil region 88 286 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
coiled coil region 378 420 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 550 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115336
AA Change: E260G

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110993
Gene: ENSMUSG00000039632
AA Change: E260G

DomainStartEndE-ValueType
coiled coil region 88 286 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
coiled coil region 379 421 N/A INTRINSIC
low complexity region 496 515 N/A INTRINSIC
low complexity region 551 566 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214420
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing coiled-coil domains. The encoded protein functions in outer dynein arm assembly and is required for motile cilia function. Mutations in this gene result in primary ciliary dyskinesia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mico homozygous for an ENU-induced allele exhibit dextrocardia associated with situs inversus totalis and hypoplastic spleen, adrenal anomalies and immotile/dyskinetic tracheal airway cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vgll4 A G 6: 114,890,615 probably null Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Ccdc151
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Ccdc151 APN 9 21995379 critical splice acceptor site probably null
IGL01922:Ccdc151 APN 9 21993530 unclassified probably benign
IGL02223:Ccdc151 APN 9 21993612 missense probably damaging 1.00
IGL03161:Ccdc151 APN 9 22002315 missense probably benign 0.02
IGL03269:Ccdc151 APN 9 21998043 critical splice donor site probably null
R0118:Ccdc151 UTSW 9 21995057 missense probably benign 0.03
R0129:Ccdc151 UTSW 9 21993552 missense probably damaging 0.98
R0279:Ccdc151 UTSW 9 21990247 unclassified probably benign
R0390:Ccdc151 UTSW 9 21991708 missense probably benign 0.00
R1349:Ccdc151 UTSW 9 21993620 missense probably damaging 1.00
R1372:Ccdc151 UTSW 9 21993620 missense probably damaging 1.00
R1891:Ccdc151 UTSW 9 21995381 splice site probably null
R2044:Ccdc151 UTSW 9 21991858 missense possibly damaging 0.95
R5116:Ccdc151 UTSW 9 21990128 makesense probably null
R5929:Ccdc151 UTSW 9 22002422 missense possibly damaging 0.50
R6182:Ccdc151 UTSW 9 21990402 missense probably damaging 1.00
R7253:Ccdc151 UTSW 9 22002471 missense probably damaging 1.00
R7498:Ccdc151 UTSW 9 22002257 missense probably damaging 1.00
R7742:Ccdc151 UTSW 9 21992897 missense possibly damaging 0.82
R8331:Ccdc151 UTSW 9 21991711 missense probably damaging 1.00
Z1176:Ccdc151 UTSW 9 21990424 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CTAGTGCTAGCCAAGTTGGTC -3'
(R):5'- CAGCTCAAGTCTTACCTCCAGG -3'

Sequencing Primer
(F):5'- GAACTCACTGAGCTCCTGC -3'
(R):5'- CAGGTGGGAACACTTTGT -3'
Posted On2016-06-21