Mutagenetix > Incidental Mutations

Incidental Mutation 'R0449:Ptprh'

39516

Institutional Source

Beutler Lab

Gene Symbol

Ptprh

Ensembl Gene

ENSMUSG00000035429

Gene Name

protein tyrosine phosphatase, receptor type, H

Synonyms

SAP-1

MMRRC Submission

038649-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0449 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4548612-4604041 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4598006 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 124 (D124V)

Ref Sequence

ENSEMBL: ENSMUSP00000145543 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049113] [ENSMUST00000166650] [ENSMUST00000206999]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049113
AA Change: D124V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000042396
Gene: ENSMUSG00000035429
AA Change: D124V

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FN3	67	145	2.42e-9	SMART
FN3	156	234	9.69e-9	SMART
FN3	245	323	1.57e-8	SMART
FN3	334	412	6.29e-8	SMART
FN3	427	505	7.75e-8	SMART
FN3	516	593	1.21e0	SMART
transmembrane domain	605	627	N/A	INTRINSIC
PTPc	670	932	1.09e-132	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166650
AA Change: D124V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125833
Gene: ENSMUSG00000035429
AA Change: D124V

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FN3	67	145	2.42e-9	SMART
FN3	156	234	9.69e-9	SMART
FN3	245	323	1.57e-8	SMART
FN3	334	412	6.29e-8	SMART
FN3	427	505	7.75e-8	SMART
FN3	516	593	1.21e0	SMART
transmembrane domain	605	627	N/A	INTRINSIC
PTPc	670	932	1.09e-132	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205341

Predicted Effect

probably damaging
Transcript: ENSMUST00000206999
AA Change: D124V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. The extracellular region contains eight fibronectin type III-like repeats and multiple N-glycosylation sites. The gene was shown to be expressed primarily in brain and liver, and at a lower level in heart and stomach. It was also found to be expressed in several cancer cell lines, but not in the corresponding normal tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null alllele exhibit normal intestinal epithelial cell morphology and physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	A	T	5: 8,939,885	R813*	probably null	Het
Accsl	T	A	2: 93,866,074	I60F	probably benign	Het
Adam29	C	T	8: 55,872,681	G246D	probably benign	Het
Ankrd13c	A	G	3: 157,991,714	I319V	probably benign	Het
B020004J07Rik	T	C	4: 101,836,961	S242G	probably benign	Het
Bag6	T	G	17: 35,141,466	V327G	probably damaging	Het
Barhl1	C	T	2: 28,915,292	A130T	probably benign	Het
Bend4	T	C	5: 67,398,240	D541G	probably damaging	Het
Birc6	A	C	17: 74,692,295	T4673P	probably damaging	Het
Ccdc81	T	C	7: 89,890,471	R186G	probably damaging	Het
Cdyl2	A	G	8: 116,583,192	F342L	probably damaging	Het
Chd3	C	A	11: 69,357,541	V748L	probably damaging	Het
CN725425	G	T	15: 91,238,944	R72I	possibly damaging	Het
Col22a1	A	G	15: 71,962,671		probably null	Het
Cops3	A	G	11: 59,818,417		probably null	Het
Ctnnd1	G	T	2: 84,603,262	Q940K	possibly damaging	Het
Dtnb	C	T	12: 3,591,971	Q45*	probably null	Het
Efr3a	T	A	15: 65,842,704	I280K	probably damaging	Het
Eml6	A	C	11: 29,893,213	V167G	probably benign	Het
Fam83c	T	A	2: 155,830,295	M407L	probably benign	Het
Fasn	T	C	11: 120,811,068	T1862A	probably benign	Het
Fbxl6	A	G	15: 76,535,955	I486T	probably damaging	Het
Gpr182	A	G	10: 127,750,696	Y129H	probably damaging	Het
Gpr75	A	G	11: 30,892,456	S454G	probably damaging	Het
Hectd4	G	A	5: 121,364,590		probably null	Het
Hsf4	A	G	8: 105,275,590	T411A	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Il4	A	T	11: 53,618,605	M1K	probably null	Het
Ints11	G	T	4: 155,887,948	R463L	probably benign	Het
Ints4	G	A	7: 97,529,223	E677K	probably damaging	Het
Klk1b11	G	A	7: 43,997,792	C50Y	probably damaging	Het
Krt14	C	A	11: 100,207,395	G21C	unknown	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
L3mbtl2	C	T	15: 81,668,741	A125V	probably damaging	Het
Lama3	A	G	18: 12,500,512		probably null	Het
Lrrk2	T	C	15: 91,750,275	L1414P	probably damaging	Het
Matn2	T	C	15: 34,428,541	S684P	probably damaging	Het
Mga	T	A	2: 119,941,381	V1574D	probably damaging	Het
Mia2	T	C	12: 59,172,594		probably null	Het
Mrpl21	T	A	19: 3,292,459		probably benign	Het
Msh5	T	A	17: 35,041,482	Q266L	probably benign	Het
Mybpc1	C	A	10: 88,540,960	C758F	probably damaging	Het
Myo15	G	A	11: 60,509,596	A2932T	possibly damaging	Het
Nbas	T	A	12: 13,519,108	I2021K	probably benign	Het
Neurl4	T	C	11: 69,905,567	S424P	probably damaging	Het
Olfr16	T	A	1: 172,957,398	V201E	probably damaging	Het
Olfr322	A	C	11: 58,665,963	I135L	probably benign	Het
Olfr782	A	G	10: 129,351,234	M224V	probably benign	Het
Olfr829	T	C	9: 18,856,649	M8T	probably benign	Het
Olfr850	T	A	9: 19,478,092	I53F	possibly damaging	Het
Phlpp1	C	T	1: 106,350,578	R907W	probably damaging	Het
Pigg	T	C	5: 108,336,411	V508A	probably benign	Het
Pkhd1l1	T	G	15: 44,501,519	Y685D	probably damaging	Het
Polr3a	A	T	14: 24,484,466	I34N	probably damaging	Het
Prex1	A	G	2: 166,569,377	V1434A	probably benign	Het
Rad54b	T	A	4: 11,606,131	I513N	probably benign	Het
Rbm12b1	A	G	4: 12,145,507	N493S	probably benign	Het
Rfx7	A	T	9: 72,610,304		probably null	Het
Serpini1	A	G	3: 75,613,341	K82E	probably benign	Het
Slc27a6	T	G	18: 58,609,165		probably null	Het
Slc35f2	G	T	9: 53,816,917	L358F	probably damaging	Het
Slc45a1	A	C	4: 150,643,305	I158M	probably damaging	Het
Slurp2	G	A	15: 74,743,106	P62L	probably damaging	Het
Sspo	C	T	6: 48,466,740	H1949Y	probably damaging	Het
Tiam1	A	T	16: 89,837,827	V865E	possibly damaging	Het
Tlr4	A	C	4: 66,839,620	I217L	probably damaging	Het
Top1	C	T	2: 160,712,708	R460*	probably null	Het
Trpm3	T	A	19: 22,988,054	S1638T	probably benign	Het
Tubgcp5	C	T	7: 55,823,567	R798C	probably benign	Het
Vars	T	G	17: 35,012,727		probably null	Het
Xylt2	A	G	11: 94,666,333	Y111H	probably benign	Het
Zbed5	G	A	5: 129,901,726	G172D	probably damaging	Het
Zfp53	C	T	17: 21,508,833	T376I	probably benign	Het
Zfp937	G	T	2: 150,239,546	V499L	probably benign	Het
Zyx	T	A	6: 42,351,313	L152Q	probably damaging	Het

Other mutations in Ptprh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01766:Ptprh	APN	7	4580916	missense	probably benign	0.23
IGL02420:Ptprh	APN	7	4580930	missense	probably damaging	1.00
IGL02619:Ptprh	APN	7	4549499	missense	probably damaging	1.00
IGL02729:Ptprh	APN	7	4580874	missense	probably damaging	0.99
BB008:Ptprh	UTSW	7	4571988	missense	probably benign	0.03
BB018:Ptprh	UTSW	7	4571988	missense	probably benign	0.03
R0018:Ptprh	UTSW	7	4601846	critical splice donor site	probably null
R0049:Ptprh	UTSW	7	4573362	missense	possibly damaging	0.80
R0477:Ptprh	UTSW	7	4597998	missense	possibly damaging	0.87
R0626:Ptprh	UTSW	7	4564272	missense	probably benign	0.00
R0741:Ptprh	UTSW	7	4554173	critical splice donor site	probably null
R1068:Ptprh	UTSW	7	4549463	missense	possibly damaging	0.89
R1226:Ptprh	UTSW	7	4603092	nonsense	probably null
R1487:Ptprh	UTSW	7	4552738	missense	probably damaging	1.00
R1495:Ptprh	UTSW	7	4580889	missense	probably benign	0.02
R1537:Ptprh	UTSW	7	4549699	missense	probably damaging	1.00
R1601:Ptprh	UTSW	7	4552638	missense	probably damaging	1.00
R1731:Ptprh	UTSW	7	4601913	missense	probably benign	0.00
R1920:Ptprh	UTSW	7	4549395	missense	probably benign	0.25
R2082:Ptprh	UTSW	7	4550775	missense	probably damaging	1.00
R2180:Ptprh	UTSW	7	4601868	missense	probably benign	0.26
R2214:Ptprh	UTSW	7	4552922	missense	possibly damaging	0.78
R2245:Ptprh	UTSW	7	4573346	missense	probably benign	0.09
R2271:Ptprh	UTSW	7	4603133	start gained	probably benign
R3693:Ptprh	UTSW	7	4554235	missense	probably damaging	0.99
R3713:Ptprh	UTSW	7	4571970	missense	probably damaging	1.00
R4081:Ptprh	UTSW	7	4580988	missense	probably damaging	0.99
R4205:Ptprh	UTSW	7	4597992	missense	probably damaging	1.00
R4689:Ptprh	UTSW	7	4597997	missense	possibly damaging	0.74
R4782:Ptprh	UTSW	7	4569577	missense	probably benign	0.08
R4838:Ptprh	UTSW	7	4573430	missense	possibly damaging	0.78
R4974:Ptprh	UTSW	7	4551007	splice site	probably null
R5218:Ptprh	UTSW	7	4597920	missense	probably benign	0.05
R5430:Ptprh	UTSW	7	4551047	missense	probably damaging	1.00
R5533:Ptprh	UTSW	7	4549505	missense	probably damaging	1.00
R5544:Ptprh	UTSW	7	4580910	nonsense	probably null
R5547:Ptprh	UTSW	7	4554222	nonsense	probably null
R5869:Ptprh	UTSW	7	4601940	missense	probably benign	0.00
R5928:Ptprh	UTSW	7	4573508	missense	probably damaging	1.00
R6063:Ptprh	UTSW	7	4573362	missense	possibly damaging	0.80
R6112:Ptprh	UTSW	7	4597923	missense	probably benign	0.01
R6493:Ptprh	UTSW	7	4580990	missense	possibly damaging	0.65
R6733:Ptprh	UTSW	7	4603044	splice site	probably null
R6836:Ptprh	UTSW	7	4551135	missense	probably damaging	1.00
R6859:Ptprh	UTSW	7	4549371	nonsense	probably null
R6868:Ptprh	UTSW	7	4601865	missense	probably benign
R7015:Ptprh	UTSW	7	4552627	critical splice donor site	probably null
R7092:Ptprh	UTSW	7	4580861	critical splice donor site	probably null
R7147:Ptprh	UTSW	7	4550782	missense	probably damaging	1.00
R7177:Ptprh	UTSW	7	4569481	missense	possibly damaging	0.77
R7358:Ptprh	UTSW	7	4551007	splice site	probably null
R7436:Ptprh	UTSW	7	4552743	missense	probably damaging	1.00
R7512:Ptprh	UTSW	7	4571781	missense	possibly damaging	0.60
R7863:Ptprh	UTSW	7	4603098	start codon destroyed	probably benign	0.31
R7931:Ptprh	UTSW	7	4571988	missense	probably benign	0.03
R7973:Ptprh	UTSW	7	4580888	missense	possibly damaging	0.55
R8239:Ptprh	UTSW	7	4581091	missense	probably damaging	1.00
R8331:Ptprh	UTSW	7	4549481	missense	probably damaging	1.00
RF022:Ptprh	UTSW	7	4549368	missense	probably benign
Z1177:Ptprh	UTSW	7	4597971	missense	probably damaging	0.99
Z1177:Ptprh	UTSW	7	4598118	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTCACAACAAAGGGATCAGAGACCAG -3'
(R):5'- GGTCGAAGGTCAAAACAACATCTCCA -3'

Sequencing Primer
(F):5'- cagagaaccagacacccag -3'
(R):5'- ATCAGCCTGAGCTGGGAG -3'

Posted On

2013-05-23