Incidental Mutation 'R0449:Ptprh'
ID39516
Institutional Source Beutler Lab
Gene Symbol Ptprh
Ensembl Gene ENSMUSG00000035429
Gene Nameprotein tyrosine phosphatase, receptor type, H
SynonymsSAP-1
MMRRC Submission 038649-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0449 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4548612-4604041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4598006 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 124 (D124V)
Ref Sequence ENSEMBL: ENSMUSP00000145543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049113] [ENSMUST00000166650] [ENSMUST00000206999]
Predicted Effect probably damaging
Transcript: ENSMUST00000049113
AA Change: D124V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042396
Gene: ENSMUSG00000035429
AA Change: D124V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166650
AA Change: D124V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125833
Gene: ENSMUSG00000035429
AA Change: D124V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205341
Predicted Effect probably damaging
Transcript: ENSMUST00000206999
AA Change: D124V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. The extracellular region contains eight fibronectin type III-like repeats and multiple N-glycosylation sites. The gene was shown to be expressed primarily in brain and liver, and at a lower level in heart and stomach. It was also found to be expressed in several cancer cell lines, but not in the corresponding normal tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null alllele exhibit normal intestinal epithelial cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,939,885 R813* probably null Het
Accsl T A 2: 93,866,074 I60F probably benign Het
Adam29 C T 8: 55,872,681 G246D probably benign Het
Ankrd13c A G 3: 157,991,714 I319V probably benign Het
B020004J07Rik T C 4: 101,836,961 S242G probably benign Het
Bag6 T G 17: 35,141,466 V327G probably damaging Het
Barhl1 C T 2: 28,915,292 A130T probably benign Het
Bend4 T C 5: 67,398,240 D541G probably damaging Het
Birc6 A C 17: 74,692,295 T4673P probably damaging Het
Ccdc81 T C 7: 89,890,471 R186G probably damaging Het
Cdyl2 A G 8: 116,583,192 F342L probably damaging Het
Chd3 C A 11: 69,357,541 V748L probably damaging Het
CN725425 G T 15: 91,238,944 R72I possibly damaging Het
Col22a1 A G 15: 71,962,671 probably null Het
Cops3 A G 11: 59,818,417 probably null Het
Ctnnd1 G T 2: 84,603,262 Q940K possibly damaging Het
Dtnb C T 12: 3,591,971 Q45* probably null Het
Efr3a T A 15: 65,842,704 I280K probably damaging Het
Eml6 A C 11: 29,893,213 V167G probably benign Het
Fam83c T A 2: 155,830,295 M407L probably benign Het
Fasn T C 11: 120,811,068 T1862A probably benign Het
Fbxl6 A G 15: 76,535,955 I486T probably damaging Het
Gpr182 A G 10: 127,750,696 Y129H probably damaging Het
Gpr75 A G 11: 30,892,456 S454G probably damaging Het
Hectd4 G A 5: 121,364,590 probably null Het
Hsf4 A G 8: 105,275,590 T411A probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il4 A T 11: 53,618,605 M1K probably null Het
Ints11 G T 4: 155,887,948 R463L probably benign Het
Ints4 G A 7: 97,529,223 E677K probably damaging Het
Klk1b11 G A 7: 43,997,792 C50Y probably damaging Het
Krt14 C A 11: 100,207,395 G21C unknown Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Lama3 A G 18: 12,500,512 probably null Het
Lrrk2 T C 15: 91,750,275 L1414P probably damaging Het
Matn2 T C 15: 34,428,541 S684P probably damaging Het
Mga T A 2: 119,941,381 V1574D probably damaging Het
Mia2 T C 12: 59,172,594 probably null Het
Mrpl21 T A 19: 3,292,459 probably benign Het
Msh5 T A 17: 35,041,482 Q266L probably benign Het
Mybpc1 C A 10: 88,540,960 C758F probably damaging Het
Myo15 G A 11: 60,509,596 A2932T possibly damaging Het
Nbas T A 12: 13,519,108 I2021K probably benign Het
Neurl4 T C 11: 69,905,567 S424P probably damaging Het
Olfr16 T A 1: 172,957,398 V201E probably damaging Het
Olfr322 A C 11: 58,665,963 I135L probably benign Het
Olfr782 A G 10: 129,351,234 M224V probably benign Het
Olfr829 T C 9: 18,856,649 M8T probably benign Het
Olfr850 T A 9: 19,478,092 I53F possibly damaging Het
Phlpp1 C T 1: 106,350,578 R907W probably damaging Het
Pigg T C 5: 108,336,411 V508A probably benign Het
Pkhd1l1 T G 15: 44,501,519 Y685D probably damaging Het
Polr3a A T 14: 24,484,466 I34N probably damaging Het
Prex1 A G 2: 166,569,377 V1434A probably benign Het
Rad54b T A 4: 11,606,131 I513N probably benign Het
Rbm12b1 A G 4: 12,145,507 N493S probably benign Het
Rfx7 A T 9: 72,610,304 probably null Het
Serpini1 A G 3: 75,613,341 K82E probably benign Het
Slc27a6 T G 18: 58,609,165 probably null Het
Slc35f2 G T 9: 53,816,917 L358F probably damaging Het
Slc45a1 A C 4: 150,643,305 I158M probably damaging Het
Slurp2 G A 15: 74,743,106 P62L probably damaging Het
Sspo C T 6: 48,466,740 H1949Y probably damaging Het
Tiam1 A T 16: 89,837,827 V865E possibly damaging Het
Tlr4 A C 4: 66,839,620 I217L probably damaging Het
Top1 C T 2: 160,712,708 R460* probably null Het
Trpm3 T A 19: 22,988,054 S1638T probably benign Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Vars T G 17: 35,012,727 probably null Het
Xylt2 A G 11: 94,666,333 Y111H probably benign Het
Zbed5 G A 5: 129,901,726 G172D probably damaging Het
Zfp53 C T 17: 21,508,833 T376I probably benign Het
Zfp937 G T 2: 150,239,546 V499L probably benign Het
Zyx T A 6: 42,351,313 L152Q probably damaging Het
Other mutations in Ptprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Ptprh APN 7 4580916 missense probably benign 0.23
IGL02420:Ptprh APN 7 4580930 missense probably damaging 1.00
IGL02619:Ptprh APN 7 4549499 missense probably damaging 1.00
IGL02729:Ptprh APN 7 4580874 missense probably damaging 0.99
R0018:Ptprh UTSW 7 4601846 critical splice donor site probably null
R0049:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R0477:Ptprh UTSW 7 4597998 missense possibly damaging 0.87
R0626:Ptprh UTSW 7 4564272 missense probably benign 0.00
R0741:Ptprh UTSW 7 4554173 critical splice donor site probably null
R1068:Ptprh UTSW 7 4549463 missense possibly damaging 0.89
R1226:Ptprh UTSW 7 4603092 nonsense probably null
R1487:Ptprh UTSW 7 4552738 missense probably damaging 1.00
R1495:Ptprh UTSW 7 4580889 missense probably benign 0.02
R1537:Ptprh UTSW 7 4549699 missense probably damaging 1.00
R1601:Ptprh UTSW 7 4552638 missense probably damaging 1.00
R1731:Ptprh UTSW 7 4601913 missense probably benign 0.00
R1920:Ptprh UTSW 7 4549395 missense probably benign 0.25
R2082:Ptprh UTSW 7 4550775 missense probably damaging 1.00
R2180:Ptprh UTSW 7 4601868 missense probably benign 0.26
R2214:Ptprh UTSW 7 4552922 missense possibly damaging 0.78
R2245:Ptprh UTSW 7 4573346 missense probably benign 0.09
R2271:Ptprh UTSW 7 4603133 start gained probably benign
R3693:Ptprh UTSW 7 4554235 missense probably damaging 0.99
R3713:Ptprh UTSW 7 4571970 missense probably damaging 1.00
R4081:Ptprh UTSW 7 4580988 missense probably damaging 0.99
R4205:Ptprh UTSW 7 4597992 missense probably damaging 1.00
R4689:Ptprh UTSW 7 4597997 missense possibly damaging 0.74
R4782:Ptprh UTSW 7 4569577 missense probably benign 0.08
R4838:Ptprh UTSW 7 4573430 missense possibly damaging 0.78
R4974:Ptprh UTSW 7 4551007 splice site probably null
R5218:Ptprh UTSW 7 4597920 missense probably benign 0.05
R5430:Ptprh UTSW 7 4551047 missense probably damaging 1.00
R5533:Ptprh UTSW 7 4549505 missense probably damaging 1.00
R5544:Ptprh UTSW 7 4580910 nonsense probably null
R5547:Ptprh UTSW 7 4554222 nonsense probably null
R5869:Ptprh UTSW 7 4601940 missense probably benign 0.00
R5928:Ptprh UTSW 7 4573508 missense probably damaging 1.00
R6063:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R6112:Ptprh UTSW 7 4597923 missense probably benign 0.01
R6493:Ptprh UTSW 7 4580990 missense possibly damaging 0.65
R6733:Ptprh UTSW 7 4603044 splice site probably null
R6836:Ptprh UTSW 7 4551135 missense probably damaging 1.00
R6859:Ptprh UTSW 7 4549371 nonsense probably null
R6868:Ptprh UTSW 7 4601865 missense probably benign
R7015:Ptprh UTSW 7 4552627 critical splice donor site probably null
R7092:Ptprh UTSW 7 4580861 critical splice donor site probably null
R7147:Ptprh UTSW 7 4550782 missense probably damaging 1.00
R7177:Ptprh UTSW 7 4569481 missense possibly damaging 0.77
R7358:Ptprh UTSW 7 4551007 splice site probably null
R7436:Ptprh UTSW 7 4552743 missense probably damaging 1.00
R7512:Ptprh UTSW 7 4571781 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CATTCACAACAAAGGGATCAGAGACCAG -3'
(R):5'- GGTCGAAGGTCAAAACAACATCTCCA -3'

Sequencing Primer
(F):5'- cagagaaccagacacccag -3'
(R):5'- ATCAGCCTGAGCTGGGAG -3'
Posted On2013-05-23