Mutagenetix > Incidental Mutation

Incidental Mutation 'R5147:Abca7'

395162

Institutional Source

Beutler Lab

Gene Symbol

Abca7

Ensembl Gene

ENSMUSG00000035722

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 7

Synonyms

Abc51

MMRRC Submission

042731-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5147 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79996494-80015572 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80015315 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 2121 (Y2121H)

Ref Sequence

ENSEMBL: ENSMUSP00000128121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043311] [ENSMUST00000043866] [ENSMUST00000099501] [ENSMUST00000105373] [ENSMUST00000132517] [ENSMUST00000171637]

AlphaFold

Q91V24

Predicted Effect

probably benign
Transcript: ENSMUST00000043311

SMART Domains

Protein: ENSMUSP00000041019
Gene: ENSMUSG00000035697

Domain	Start	End	E-Value	Type
low complexity region	142	153	N/A	INTRINSIC
FCH	157	244	4.14e-17	SMART
low complexity region	255	269	N/A	INTRINSIC
low complexity region	309	324	N/A	INTRINSIC
low complexity region	330	345	N/A	INTRINSIC
low complexity region	527	536	N/A	INTRINSIC
C1	582	628	3.15e-8	SMART
RhoGAP	653	852	2.73e-73	SMART
low complexity region	856	869	N/A	INTRINSIC
Blast:RhoGAP	876	999	1e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000043866
AA Change: Y2113H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000043090
Gene: ENSMUSG00000035722
AA Change: Y2113H

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	515	747	1.1e-17	PFAM
AAA	830	1011	4.97e-12	SMART
low complexity region	1136	1147	N/A	INTRINSIC
transmembrane domain	1241	1263	N/A	INTRINSIC
low complexity region	1299	1309	N/A	INTRINSIC
low complexity region	1374	1390	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1427	1764	9e-43	PFAM
AAA	1833	2018	7.2e-9	SMART
low complexity region	2120	2135	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099501

SMART Domains

Protein: ENSMUSP00000097100
Gene: ENSMUSG00000035697

Domain	Start	End	E-Value	Type
low complexity region	258	269	N/A	INTRINSIC
FCH	273	360	4.14e-17	SMART
low complexity region	371	385	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
low complexity region	446	461	N/A	INTRINSIC
low complexity region	643	652	N/A	INTRINSIC
C1	698	744	3.15e-8	SMART
RhoGAP	769	968	2.73e-73	SMART
low complexity region	972	985	N/A	INTRINSIC
Blast:RhoGAP	992	1115	1e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000105373

SMART Domains

Protein: ENSMUSP00000101012
Gene: ENSMUSG00000035697

Domain	Start	End	E-Value	Type
low complexity region	269	280	N/A	INTRINSIC
FCH	284	371	4.14e-17	SMART
low complexity region	382	396	N/A	INTRINSIC
low complexity region	436	451	N/A	INTRINSIC
low complexity region	457	472	N/A	INTRINSIC
low complexity region	654	663	N/A	INTRINSIC
C1	709	755	3.15e-8	SMART
RhoGAP	780	979	2.73e-73	SMART
low complexity region	983	996	N/A	INTRINSIC
Blast:RhoGAP	1003	1126	1e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000132517
AA Change: Y2113H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000115111
Gene: ENSMUSG00000035722
AA Change: Y2113H

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	515	747	1.1e-17	PFAM
AAA	830	1011	4.97e-12	SMART
low complexity region	1136	1147	N/A	INTRINSIC
transmembrane domain	1241	1263	N/A	INTRINSIC
low complexity region	1299	1309	N/A	INTRINSIC
low complexity region	1374	1390	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1427	1764	9e-43	PFAM
AAA	1833	2018	7.2e-9	SMART
low complexity region	2120	2135	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140974

Predicted Effect

probably benign
Transcript: ENSMUST00000171637
AA Change: Y2121H

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000128121
Gene: ENSMUSG00000035722
AA Change: Y2121H

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	517	747	2.8e-19	PFAM
AAA	830	1011	4.97e-12	SMART
low complexity region	1136	1147	N/A	INTRINSIC
transmembrane domain	1249	1271	N/A	INTRINSIC
low complexity region	1307	1317	N/A	INTRINSIC
low complexity region	1382	1398	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1426	1772	3.9e-47	PFAM
AAA	1841	2026	7.2e-9	SMART
low complexity region	2128	2143	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is widely expressed with highest detection in spleen and hematopoietic tissues. Defects in this gene cause an increase in amyloid-beta deposits in a mouse model of Alzheimer's disease, and a related human protein is thought to play a role in lipid homeostasis in cells of the immune system. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant females, but not males, have less white fat and lower total serum and HDL cholesterol levels. Males exhibit a 10% reduction in kidney size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf2	A	G	17: 42,710,683	Y417H	probably damaging	Het
Ap5z1	A	C	5: 142,466,510	D66A	probably benign	Het
Cachd1	T	A	4: 100,964,491	Y422N	probably damaging	Het
Ccdc151	T	C	9: 21,994,862	E260G	probably benign	Het
Cfap54	C	T	10: 92,937,838	G114D	probably benign	Het
Cgref1	C	T	5: 30,933,705	G255E	probably benign	Het
Cyp2a22	A	C	7: 26,936,325	L271R	probably damaging	Het
Dcp2	G	T	18: 44,417,595	E379*	probably null	Het
Fhl3	T	A	4: 124,707,931	D277E	probably benign	Het
Gm19684	C	T	17: 36,128,519	V190M	probably damaging	Het
Hpse	T	C	5: 100,719,509	D29G	probably benign	Het
Il31	T	C	5: 123,482,058		probably benign	Het
Ilk	T	C	7: 105,742,567	C422R	possibly damaging	Het
Itga1	T	G	13: 114,985,142	D777A	possibly damaging	Het
Kank3	A	G	17: 33,822,202	D556G	probably damaging	Het
Lrit3	A	G	3: 129,803,925	S36P	possibly damaging	Het
Magi1	C	T	6: 93,747,267	E256K	probably damaging	Het
Mroh9	C	G	1: 163,060,760	G249R	probably damaging	Het
Mymk	C	T	2: 27,062,287	M148I	probably benign	Het
Nlrp12	T	A	7: 3,241,373	I170F	possibly damaging	Het
Olfr1043	A	T	2: 86,162,034	I305K	possibly damaging	Het
Olfr235	T	A	19: 12,268,904	S225T	probably damaging	Het
Pkd1l1	G	A	11: 8,849,003	T1803I	possibly damaging	Het
Ppp2r2b	C	T	18: 42,645,877	V398I	probably benign	Het
Ppp2r5e	T	A	12: 75,469,770	R214S	probably damaging	Het
Prss16	T	C	13: 22,006,094	D298G	possibly damaging	Het
Qprt	G	A	7: 127,108,450	R189W	probably damaging	Het
Rara	C	T	11: 98,950,724	S36F	probably benign	Het
Rasal2	A	G	1: 157,175,694	V465A	probably damaging	Het
Slc22a1	C	T	17: 12,650,951	G508R	probably damaging	Het
Slco2a1	C	A	9: 103,050,269	F120L	probably damaging	Het
Tex15	T	A	8: 33,572,312	L864*	probably null	Het
Tssk4	A	G	14: 55,650,973	I100V	possibly damaging	Het
Vgll4	A	G	6: 114,890,615		probably null	Het
Vmn1r65	T	G	7: 6,008,819	I139L	probably benign	Het
Vps13b	C	T	15: 35,456,678	P757S	probably benign	Het
Ythdc2	G	A	18: 44,844,292	G385E	probably damaging	Het

Other mutations in Abca7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Abca7	APN	10	80011297	missense	probably damaging	0.96
IGL01074:Abca7	APN	10	80013892	missense	possibly damaging	0.88
IGL01313:Abca7	APN	10	80003123	splice site	probably benign
IGL01372:Abca7	APN	10	80006255	missense	probably benign	0.00
IGL01387:Abca7	APN	10	79999762	missense	possibly damaging	0.71
IGL01468:Abca7	APN	10	80003877	missense	probably benign	0.21
IGL01648:Abca7	APN	10	80011080	missense	probably damaging	1.00
IGL01796:Abca7	APN	10	80013909	missense	probably damaging	0.99
IGL01977:Abca7	APN	10	80006152	missense	probably benign	0.31
IGL01982:Abca7	APN	10	80002641	missense	probably damaging	1.00
IGL02115:Abca7	APN	10	79998079	missense	probably damaging	1.00
IGL02437:Abca7	APN	10	80008389	missense	probably damaging	1.00
IGL02721:Abca7	APN	10	80013635	missense	possibly damaging	0.93
IGL02812:Abca7	APN	10	80006047	missense	possibly damaging	0.84
IGL02823:Abca7	APN	10	80008822	missense	probably damaging	1.00
IGL02827:Abca7	APN	10	80009865	missense	probably damaging	1.00
IGL02897:Abca7	APN	10	80001592	missense	probably damaging	1.00
IGL02952:Abca7	APN	10	80007408	missense	probably damaging	1.00
R0507:Abca7	UTSW	10	80002821	splice site	probably benign
R0528:Abca7	UTSW	10	80003014	missense	probably damaging	1.00
R0541:Abca7	UTSW	10	80007351	missense	probably benign	0.01
R0584:Abca7	UTSW	10	80011730	missense	probably damaging	1.00
R1018:Abca7	UTSW	10	80001491	missense	probably damaging	1.00
R1099:Abca7	UTSW	10	80013743	nonsense	probably null
R1520:Abca7	UTSW	10	80008830	missense	possibly damaging	0.69
R1536:Abca7	UTSW	10	80014230	missense	probably benign	0.39
R1619:Abca7	UTSW	10	80009055	missense	probably damaging	1.00
R1636:Abca7	UTSW	10	80008998	missense	probably benign
R1752:Abca7	UTSW	10	80006634	missense	probably benign	0.17
R1762:Abca7	UTSW	10	79999765	missense	probably damaging	1.00
R1764:Abca7	UTSW	10	80008950	missense	probably damaging	1.00
R1891:Abca7	UTSW	10	80005040	missense	possibly damaging	0.72
R1911:Abca7	UTSW	10	80006634	missense	probably benign	0.17
R2032:Abca7	UTSW	10	80008237	missense	probably damaging	1.00
R2188:Abca7	UTSW	10	80002533	missense	probably damaging	1.00
R2973:Abca7	UTSW	10	80008967	missense	probably damaging	1.00
R2974:Abca7	UTSW	10	80008967	missense	probably damaging	1.00
R3055:Abca7	UTSW	10	79999747	missense	probably damaging	1.00
R4496:Abca7	UTSW	10	80002934	missense	probably damaging	1.00
R4570:Abca7	UTSW	10	80006694	missense	probably damaging	1.00
R4581:Abca7	UTSW	10	80006568	missense	probably benign	0.03
R4588:Abca7	UTSW	10	79997867	splice site	probably null
R4628:Abca7	UTSW	10	80015188	critical splice donor site	probably null
R4641:Abca7	UTSW	10	80005781	critical splice donor site	probably null
R4888:Abca7	UTSW	10	80002728	missense	probably damaging	0.97
R4911:Abca7	UTSW	10	80012188	critical splice donor site	probably null
R4979:Abca7	UTSW	10	80004783	nonsense	probably null
R4997:Abca7	UTSW	10	80007320	missense	possibly damaging	0.90
R5176:Abca7	UTSW	10	79998289	missense	probably benign	0.35
R5190:Abca7	UTSW	10	79999593	critical splice donor site	probably null
R5358:Abca7	UTSW	10	80013331	missense	probably damaging	0.99
R5409:Abca7	UTSW	10	80014320	missense	probably damaging	1.00
R5705:Abca7	UTSW	10	80015442	missense	probably benign
R6246:Abca7	UTSW	10	80015165	missense	probably damaging	1.00
R6256:Abca7	UTSW	10	80002622	missense	probably damaging	1.00
R6260:Abca7	UTSW	10	80008987	missense	probably damaging	1.00
R6275:Abca7	UTSW	10	79997791	missense	probably damaging	1.00
R6277:Abca7	UTSW	10	80006158	missense	probably benign	0.04
R6284:Abca7	UTSW	10	80004410	missense	probably benign
R6307:Abca7	UTSW	10	80007387	missense	probably damaging	1.00
R6451:Abca7	UTSW	10	80006899	missense	probably damaging	0.99
R6456:Abca7	UTSW	10	80015150	missense	probably null	0.69
R6460:Abca7	UTSW	10	80009028	missense	probably benign	0.04
R6560:Abca7	UTSW	10	80007396	missense	probably damaging	1.00
R6565:Abca7	UTSW	10	80011788	missense	probably damaging	1.00
R6644:Abca7	UTSW	10	80008764	missense	probably damaging	0.98
R6814:Abca7	UTSW	10	80002999	missense	probably damaging	1.00
R7289:Abca7	UTSW	10	80009944	missense	probably damaging	1.00
R7303:Abca7	UTSW	10	80014988	missense	probably benign	0.17
R7493:Abca7	UTSW	10	80002062	missense	probably damaging	0.96
R7535:Abca7	UTSW	10	80001629	missense	probably benign	0.04
R7602:Abca7	UTSW	10	79998012	critical splice acceptor site	probably null
R7607:Abca7	UTSW	10	80011833	missense	probably damaging	1.00
R7647:Abca7	UTSW	10	80000822	missense	probably benign	0.00
R7821:Abca7	UTSW	10	80002590	small deletion	probably benign
R7863:Abca7	UTSW	10	80008821	missense	probably damaging	1.00
R7896:Abca7	UTSW	10	80004958	missense	probably damaging	1.00
R7911:Abca7	UTSW	10	80005033	missense	probably benign	0.00
R8114:Abca7	UTSW	10	80009040	missense	probably damaging	1.00
R8356:Abca7	UTSW	10	80006526	missense	probably benign	0.05
R8439:Abca7	UTSW	10	80006161	missense	probably benign	0.03
R8456:Abca7	UTSW	10	80006526	missense	probably benign	0.05
R8830:Abca7	UTSW	10	80008971	missense	probably damaging	1.00
R9004:Abca7	UTSW	10	80005649	missense	probably damaging	1.00
R9066:Abca7	UTSW	10	80013354	missense	probably damaging	0.98
R9116:Abca7	UTSW	10	80003139	missense
R9128:Abca7	UTSW	10	80002518	missense	possibly damaging	0.95
R9141:Abca7	UTSW	10	80015430	missense	possibly damaging	0.82
R9184:Abca7	UTSW	10	80002856	missense	probably damaging	0.97
R9246:Abca7	UTSW	10	80002701	missense	probably damaging	1.00
R9320:Abca7	UTSW	10	79997637	missense	possibly damaging	0.55
R9426:Abca7	UTSW	10	80015430	missense	possibly damaging	0.82
R9490:Abca7	UTSW	10	79998767	missense	probably benign
R9561:Abca7	UTSW	10	80001701	missense	probably damaging	1.00
R9672:Abca7	UTSW	10	80002729	missense	probably null	1.00
Z1176:Abca7	UTSW	10	79999432	nonsense	probably null
Z1176:Abca7	UTSW	10	80006559	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCCTGACACGAGTGTTCAG -3'
(R):5'- CTGTCTGAGCTTTGCCACTCAG -3'

Sequencing Primer
(F):5'- CACGAGTGTTCAGGGAGCTG -3'
(R):5'- TTGCCACTCAGTCCCAAGG -3'

Posted On

2016-06-21