Incidental Mutation 'R5147:Prss16'
ID395167
Institutional Source Beutler Lab
Gene Symbol Prss16
Ensembl Gene ENSMUSG00000006179
Gene Nameprotease, serine 16 (thymus)
SynonymsTSSP
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5147 (G1)
Quality Score197
Status Not validated
Chromosome13
Chromosomal Location22002173-22009742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22006094 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 298 (D298G)
Ref Sequence ENSEMBL: ENSMUSP00000006341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006341] [ENSMUST00000150547]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006341
AA Change: D298G

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000006341
Gene: ENSMUSG00000006179
AA Change: D298G

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 40 53 N/A INTRINSIC
Pfam:Peptidase_S28 63 493 1.9e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130585
Predicted Effect probably benign
Transcript: ENSMUST00000150547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223857
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine protease expressed exclusively in the thymus. It is thought to play a role in the alternative antigen presenting pathway used by cortical thymic epithelial cells during the positive selection of T cells. The gene is found in the large histone gene cluster on chromosome 6, near the major histocompatibility complex (MHC) class I region. A second transcript variant has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable with no gross abnormalities and normal T cell development and activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vgll4 A G 6: 114,890,615 probably null Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Prss16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Prss16 APN 13 22003021 missense probably damaging 0.99
IGL02272:Prss16 APN 13 22003035 missense probably damaging 0.96
IGL02383:Prss16 APN 13 22009527 missense probably benign 0.00
IGL02892:Prss16 APN 13 22003050 missense probably benign 0.03
IGL03325:Prss16 APN 13 22003247 missense possibly damaging 0.90
BB001:Prss16 UTSW 13 22008664 missense probably damaging 0.99
BB011:Prss16 UTSW 13 22008664 missense probably damaging 0.99
R0645:Prss16 UTSW 13 22009376 unclassified probably benign
R0970:Prss16 UTSW 13 22005117 missense probably damaging 1.00
R1146:Prss16 UTSW 13 22006968 unclassified probably benign
R1292:Prss16 UTSW 13 22009521 nonsense probably null
R1371:Prss16 UTSW 13 22008686 unclassified probably benign
R1525:Prss16 UTSW 13 22009443 missense possibly damaging 0.50
R1624:Prss16 UTSW 13 22003313 missense probably benign 0.31
R2233:Prss16 UTSW 13 22009409 missense possibly damaging 0.70
R5670:Prss16 UTSW 13 22003051 missense possibly damaging 0.74
R6440:Prss16 UTSW 13 22003160 missense probably damaging 0.97
R6668:Prss16 UTSW 13 22006748 missense probably null 0.01
R6791:Prss16 UTSW 13 22006067 missense probably damaging 0.99
R7278:Prss16 UTSW 13 22003147 missense probably damaging 1.00
R7924:Prss16 UTSW 13 22008664 missense probably damaging 0.99
R8865:Prss16 UTSW 13 22003005 missense possibly damaging 0.71
Z1176:Prss16 UTSW 13 22006054 nonsense probably null
Z1176:Prss16 UTSW 13 22006400 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGAGGAGGATTTCGGTCGTC -3'
(R):5'- GCTTCTCGCTTTCCGAAGTG -3'

Sequencing Primer
(F):5'- CGTCTGAACTCGGTGAAGG -3'
(R):5'- CGCTTTCCGAAGTGTCTGGC -3'
Posted On2016-06-21