Incidental Mutation 'R5147:Tssk4'
ID395170
Institutional Source Beutler Lab
Gene Symbol Tssk4
Ensembl Gene ENSMUSG00000007591
Gene Nametestis-specific serine kinase 4
Synonyms1700020B19Rik, 4933424F08Rik
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.629) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55650184-55652539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55650973 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 100 (I100V)
Ref Sequence ENSEMBL: ENSMUSP00000154232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007735] [ENSMUST00000164809] [ENSMUST00000226497] [ENSMUST00000226591] [ENSMUST00000227297] [ENSMUST00000228041] [ENSMUST00000228395]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007735
AA Change: I100V

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000007735
Gene: ENSMUSG00000007591
AA Change: I100V

DomainStartEndE-ValueType
Pfam:Pkinase 25 280 1.1e-54 PFAM
Pfam:Pkinase_Tyr 25 280 7.9e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164809
AA Change: I100V

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127728
Gene: ENSMUSG00000007591
AA Change: I100V

DomainStartEndE-ValueType
Pfam:Pkinase 25 281 4e-56 PFAM
Pfam:Pkinase_Tyr 25 281 3.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226497
AA Change: I100V

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000226591
AA Change: I100V

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227297
AA Change: I100V

PolyPhen 2 Score 0.562 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228007
Predicted Effect probably benign
Transcript: ENSMUST00000228041
AA Change: I100V

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000228395
AA Change: I100V

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the testis-specific serine/threonine kinase family. The encoded protein is thought to be involved in spermatogenesis via stimulation of the CREB/CRE responsive pathway through phosphorylation of the cAMP responsive element binding protein transcription factor. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Vgll4 A G 6: 114,890,615 probably null Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Tssk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Tssk4 APN 14 55650553 missense probably damaging 1.00
IGL02943:Tssk4 APN 14 55651566 missense probably damaging 1.00
IGL03082:Tssk4 APN 14 55651061 missense probably damaging 1.00
IGL03281:Tssk4 APN 14 55650428 missense possibly damaging 0.86
R0201:Tssk4 UTSW 14 55651559 nonsense probably null
R0201:Tssk4 UTSW 14 55651560 missense probably damaging 1.00
R1655:Tssk4 UTSW 14 55651695 missense probably damaging 1.00
R1660:Tssk4 UTSW 14 55650572 missense probably null 0.90
R1743:Tssk4 UTSW 14 55651031 missense probably damaging 1.00
R2103:Tssk4 UTSW 14 55651540 missense probably damaging 1.00
R3431:Tssk4 UTSW 14 55651695 missense probably damaging 1.00
R3432:Tssk4 UTSW 14 55651695 missense probably damaging 1.00
R4113:Tssk4 UTSW 14 55650373 missense probably benign 0.00
R4870:Tssk4 UTSW 14 55651815 missense probably benign 0.38
R4957:Tssk4 UTSW 14 55651809 missense probably damaging 1.00
R6785:Tssk4 UTSW 14 55650475 missense probably damaging 1.00
R6917:Tssk4 UTSW 14 55652407 missense probably benign 0.13
R7748:Tssk4 UTSW 14 55651112 missense probably damaging 1.00
Z1088:Tssk4 UTSW 14 55650923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCAAATATTCAGCTCACTATCC -3'
(R):5'- TTAAGATTCCCAAAGCCCAGTC -3'

Sequencing Primer
(F):5'- AATATTCAGCTCACTATCCAATGTCC -3'
(R):5'- AAAGCCCAGTCCGGTGAC -3'
Posted On2016-06-21