Incidental Mutation 'R5147:Slc22a1'
ID395172
Institutional Source Beutler Lab
Gene Symbol Slc22a1
Ensembl Gene ENSMUSG00000023829
Gene Namesolute carrier family 22 (organic cation transporter), member 1
SynonymsLx1, Oct1, Oct1, Orct1, Orct
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location12648874-12675838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12650951 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 508 (G508R)
Ref Sequence ENSEMBL: ENSMUSP00000024596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024596]
Predicted Effect probably damaging
Transcript: ENSMUST00000024596
AA Change: G508R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000024596
Gene: ENSMUSG00000023829
AA Change: G508R

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:MFS_1 134 482 1.3e-25 PFAM
Pfam:Sugar_tr 143 529 5.3e-33 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. Two transcript variants encoding two different isoforms have been found for this gene, but only the longer variant encodes a functional transporter. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele are viable, healthy, and fertile but exhibit an impaired liver uptake and direct intestinal excretion of substrate organic cations. Mice homozygous for a different knockout allele show alterations in metformin disposition and its glucose-lowering effects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Adgrf2 A G 17: 42,710,683 Y417H probably damaging Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vgll4 A G 6: 114,890,615 probably null Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Slc22a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Slc22a1 APN 17 12650862 splice site probably benign
IGL02313:Slc22a1 APN 17 12675500 nonsense probably null
IGL02578:Slc22a1 APN 17 12667239 missense probably damaging 1.00
R0017:Slc22a1 UTSW 17 12659759 missense probably damaging 1.00
R0136:Slc22a1 UTSW 17 12662596 missense probably benign 0.03
R0306:Slc22a1 UTSW 17 12662598 missense probably benign 0.03
R0408:Slc22a1 UTSW 17 12656941 missense probably damaging 1.00
R0487:Slc22a1 UTSW 17 12662600 nonsense probably null
R0654:Slc22a1 UTSW 17 12662792 missense probably damaging 1.00
R0811:Slc22a1 UTSW 17 12666618 splice site probably benign
R0866:Slc22a1 UTSW 17 12657046 missense probably benign 0.00
R1414:Slc22a1 UTSW 17 12662600 missense probably damaging 1.00
R1490:Slc22a1 UTSW 17 12662893 splice site probably null
R4801:Slc22a1 UTSW 17 12675535 missense probably damaging 1.00
R4802:Slc22a1 UTSW 17 12675535 missense probably damaging 1.00
R5101:Slc22a1 UTSW 17 12667242 missense probably damaging 1.00
R6816:Slc22a1 UTSW 17 12652483 missense possibly damaging 0.83
R6875:Slc22a1 UTSW 17 12667305 nonsense probably null
R7263:Slc22a1 UTSW 17 12666700 missense probably damaging 1.00
R7295:Slc22a1 UTSW 17 12657005 missense probably benign 0.09
R7947:Slc22a1 UTSW 17 12652423 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGATAACTGAGAATGTGCTG -3'
(R):5'- TGGAATCCGCTTCTGTAGTG -3'

Sequencing Primer
(F):5'- GCAATGCTGGGACCCTTTACAG -3'
(R):5'- CGCTTCTGTAGTGGCAAATAC -3'
Posted On2016-06-21