Mutagenetix > Incidental Mutation

Incidental Mutation 'R5147:Adgrf2'

395178

Institutional Source

Beutler Lab

Gene Symbol

Adgrf2

Ensembl Gene

ENSMUSG00000057899

Gene Name

adhesion G protein-coupled receptor F2

Synonyms

Gpr111, PGR20

MMRRC Submission

042731-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5147 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

42708936-42742179 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 42710683 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 417 (Y417H)

Ref Sequence

ENSEMBL: ENSMUSP00000109244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113614]

AlphaFold

E9Q4J9

Predicted Effect

probably damaging
Transcript: ENSMUST00000113614
AA Change: Y417H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109244
Gene: ENSMUSG00000057899
AA Change: Y417H

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
GPS	325	376	2.05e-4	SMART
Pfam:7tm_2	378	625	4.1e-29	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	C	10: 80,015,315	Y2121H	probably benign	Het
Ap5z1	A	C	5: 142,466,510	D66A	probably benign	Het
Cachd1	T	A	4: 100,964,491	Y422N	probably damaging	Het
Ccdc151	T	C	9: 21,994,862	E260G	probably benign	Het
Cfap54	C	T	10: 92,937,838	G114D	probably benign	Het
Cgref1	C	T	5: 30,933,705	G255E	probably benign	Het
Cyp2a22	A	C	7: 26,936,325	L271R	probably damaging	Het
Dcp2	G	T	18: 44,417,595	E379*	probably null	Het
Fhl3	T	A	4: 124,707,931	D277E	probably benign	Het
Gm19684	C	T	17: 36,128,519	V190M	probably damaging	Het
Hpse	T	C	5: 100,719,509	D29G	probably benign	Het
Il31	T	C	5: 123,482,058		probably benign	Het
Ilk	T	C	7: 105,742,567	C422R	possibly damaging	Het
Itga1	T	G	13: 114,985,142	D777A	possibly damaging	Het
Kank3	A	G	17: 33,822,202	D556G	probably damaging	Het
Lrit3	A	G	3: 129,803,925	S36P	possibly damaging	Het
Magi1	C	T	6: 93,747,267	E256K	probably damaging	Het
Mroh9	C	G	1: 163,060,760	G249R	probably damaging	Het
Mymk	C	T	2: 27,062,287	M148I	probably benign	Het
Nlrp12	T	A	7: 3,241,373	I170F	possibly damaging	Het
Olfr1043	A	T	2: 86,162,034	I305K	possibly damaging	Het
Olfr235	T	A	19: 12,268,904	S225T	probably damaging	Het
Pkd1l1	G	A	11: 8,849,003	T1803I	possibly damaging	Het
Ppp2r2b	C	T	18: 42,645,877	V398I	probably benign	Het
Ppp2r5e	T	A	12: 75,469,770	R214S	probably damaging	Het
Prss16	T	C	13: 22,006,094	D298G	possibly damaging	Het
Qprt	G	A	7: 127,108,450	R189W	probably damaging	Het
Rara	C	T	11: 98,950,724	S36F	probably benign	Het
Rasal2	A	G	1: 157,175,694	V465A	probably damaging	Het
Slc22a1	C	T	17: 12,650,951	G508R	probably damaging	Het
Slco2a1	C	A	9: 103,050,269	F120L	probably damaging	Het
Tex15	T	A	8: 33,572,312	L864*	probably null	Het
Tssk4	A	G	14: 55,650,973	I100V	possibly damaging	Het
Vgll4	A	G	6: 114,890,615		probably null	Het
Vmn1r65	T	G	7: 6,008,819	I139L	probably benign	Het
Vps13b	C	T	15: 35,456,678	P757S	probably benign	Het
Ythdc2	G	A	18: 44,844,292	G385E	probably damaging	Het

Other mutations in Adgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Adgrf2	APN	17	42714315	splice site	probably benign
IGL01089:Adgrf2	APN	17	42710158	missense	probably damaging	1.00
IGL01601:Adgrf2	APN	17	42710049	missense	probably benign
IGL01765:Adgrf2	APN	17	42719535	missense	probably benign	0.06
IGL02946:Adgrf2	APN	17	42710493	missense	probably damaging	1.00
R0498:Adgrf2	UTSW	17	42714315	splice site	probably benign
R0720:Adgrf2	UTSW	17	42713172	missense	probably damaging	1.00
R0831:Adgrf2	UTSW	17	42710443	missense	probably damaging	0.96
R1664:Adgrf2	UTSW	17	42714414	missense	possibly damaging	0.92
R2008:Adgrf2	UTSW	17	42710122	missense	probably damaging	0.96
R2306:Adgrf2	UTSW	17	42713119	missense	possibly damaging	0.92
R2519:Adgrf2	UTSW	17	42710407	missense	probably damaging	1.00
R3713:Adgrf2	UTSW	17	42713088	missense	probably damaging	1.00
R3736:Adgrf2	UTSW	17	42711012	missense	probably benign	0.32
R4272:Adgrf2	UTSW	17	42710122	missense	probably damaging	0.99
R4273:Adgrf2	UTSW	17	42710122	missense	probably damaging	0.99
R4422:Adgrf2	UTSW	17	42713155	missense	probably benign
R4732:Adgrf2	UTSW	17	42710754	missense	probably damaging	1.00
R4733:Adgrf2	UTSW	17	42710754	missense	probably damaging	1.00
R4906:Adgrf2	UTSW	17	42711193	missense	probably benign
R5053:Adgrf2	UTSW	17	42710443	missense	probably damaging	0.96
R5078:Adgrf2	UTSW	17	42710986	missense	probably damaging	1.00
R5089:Adgrf2	UTSW	17	42710097	missense	probably benign	0.00
R5953:Adgrf2	UTSW	17	42710338	missense	probably damaging	1.00
R5968:Adgrf2	UTSW	17	42715172	critical splice donor site	probably null
R6791:Adgrf2	UTSW	17	42710883	missense	probably benign	0.02
R7138:Adgrf2	UTSW	17	42710983	missense	probably damaging	1.00
R7612:Adgrf2	UTSW	17	42714380	missense	possibly damaging	0.68
R7670:Adgrf2	UTSW	17	42711372	missense	probably damaging	1.00
R8291:Adgrf2	UTSW	17	42710560	missense	probably damaging	1.00
R8418:Adgrf2	UTSW	17	42710586	missense	probably benign	0.01
R8510:Adgrf2	UTSW	17	42719540	nonsense	probably null
R9736:Adgrf2	UTSW	17	42711321	missense	probably benign	0.42
X0061:Adgrf2	UTSW	17	42713074	missense	probably benign	0.37
X0067:Adgrf2	UTSW	17	42710668	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTTGGGCAGTGTATGAAAC -3'
(R):5'- CAAGCTGTTTGCCGTTGTC -3'

Sequencing Primer
(F):5'- AGGAGAGCCTTGGCAAGCATC -3'
(R):5'- CGTTGTCGGCCGAATAAGTTATATAC -3'

Posted On

2016-06-21