Incidental Mutation 'R5148:Lin9'
ID395183
Institutional Source Beutler Lab
Gene Symbol Lin9
Ensembl Gene ENSMUSG00000058729
Gene Namelin-9 homolog (C. elegans)
Synonyms2700022J23Rik
MMRRC Submission 043262-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5148 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180641150-180690694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 180669198 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 351 (L351I)
Ref Sequence ENSEMBL: ENSMUSP00000141331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000192561] [ENSMUST00000192725] [ENSMUST00000193892]
Predicted Effect probably benign
Transcript: ENSMUST00000085803
AA Change: L335I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000082959
Gene: ENSMUSG00000058729
AA Change: L335I

DomainStartEndE-ValueType
DIRP 127 232 2.93e-67 SMART
coiled coil region 354 412 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085804
SMART Domains Protein: ENSMUSP00000082960
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 127 232 2.93e-67 SMART
coiled coil region 354 412 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
low complexity region 445 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191744
Predicted Effect probably benign
Transcript: ENSMUST00000192561
AA Change: L351I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000141331
Gene: ENSMUSG00000058729
AA Change: L351I

DomainStartEndE-ValueType
DIRP 143 248 2.2e-71 SMART
coiled coil region 370 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192725
AA Change: L311I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000141503
Gene: ENSMUSG00000058729
AA Change: L311I

DomainStartEndE-ValueType
DIRP 103 208 2.2e-71 SMART
coiled coil region 330 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193892
SMART Domains Protein: ENSMUSP00000141530
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 127 232 2.2e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194638
Meta Mutation Damage Score 0.0673 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that inhibits DNA synthesis and oncogenic transformation through association with the retinoblastoma 1 protein. The encoded protein also interacts with a complex of other cell cycle regulators to repress cell cycle-dependent gene expression in non-dividing cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show increased body weight. Mice homozygous for a gene-trap allele die shortly after implantation with defects in early embryogenesis. Homozygous deletion in adult mice causes premature death, intestinal epithelium atrophy, and abnormal mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 A T 3: 127,025,636 probably null Het
Atf7 A G 15: 102,547,173 M252T probably benign Het
Cacna1h C A 17: 25,387,545 D1027Y probably damaging Het
Cngb1 A G 8: 95,265,983 V667A probably benign Het
Cntf T C 19: 12,764,004 E164G probably damaging Het
Dbt T C 3: 116,528,244 probably benign Het
Egfem1 G A 3: 29,457,823 probably benign Het
Gm12790 C T 4: 101,968,071 V49I possibly damaging Het
Gm5444 C T 13: 4,834,315 noncoding transcript Het
Gpcpd1 A T 2: 132,534,190 Y574* probably null Het
Gss G T 2: 155,573,109 N225K possibly damaging Het
Il17rc G T 6: 113,482,997 A635S probably benign Het
Lhfpl5 T A 17: 28,579,968 D150E probably damaging Het
Lrrc40 T G 3: 158,054,569 probably null Het
Ly6f A G 15: 75,271,797 T118A probably benign Het
Malrd1 A G 2: 16,142,226 N1960D unknown Het
Map3k14 T C 11: 103,239,332 H253R probably benign Het
Morc2a T C 11: 3,689,084 L1025P probably damaging Het
Nlrc5 G T 8: 94,476,693 G474W probably damaging Het
Olfr1162 G A 2: 88,050,393 T77I probably benign Het
Olfr1487 C A 19: 13,619,510 S116* probably null Het
Olfr894 T C 9: 38,219,021 I66T probably benign Het
Olr1 G T 6: 129,493,609 D198E probably benign Het
Pafah1b1 A T 11: 74,684,452 S209T probably damaging Het
Phf14 A T 6: 11,961,642 Y426F possibly damaging Het
Phldb1 A G 9: 44,704,158 V855A probably benign Het
Pira2 T G 7: 3,844,593 R32S possibly damaging Het
Pnldc1 T C 17: 12,892,789 I344V probably benign Het
Prss29 T C 17: 25,320,907 V93A probably benign Het
Ptpn13 C T 5: 103,492,232 L186F probably damaging Het
Ralgps1 A C 2: 33,158,987 C303W probably damaging Het
Sdr42e1 T A 8: 117,663,603 N100Y probably damaging Het
Serpina11 A T 12: 103,986,244 L96Q probably damaging Het
Slc12a8 G A 16: 33,624,918 R448H probably benign Het
Snrpd1 T A 18: 10,626,892 V53E probably benign Het
Ssbp1 T C 6: 40,477,949 V114A possibly damaging Het
T A G 17: 8,436,205 E47G probably damaging Het
Tmem156 T C 5: 65,073,768 K189R probably benign Het
Trim47 G T 11: 116,107,852 Q314K possibly damaging Het
Vmn2r3 G T 3: 64,278,826 P146Q probably damaging Het
Vmn2r6 A C 3: 64,556,594 V273G probably damaging Het
Wrnip1 G T 13: 32,806,856 R366L probably damaging Het
Zfp981 A T 4: 146,536,900 H94L possibly damaging Het
Other mutations in Lin9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Lin9 APN 1 180667367 missense probably damaging 1.00
IGL02221:Lin9 APN 1 180650834 missense probably benign 0.03
IGL02233:Lin9 APN 1 180689300 missense probably damaging 0.98
IGL02370:Lin9 APN 1 180688018 missense probably damaging 1.00
IGL02794:Lin9 APN 1 180651879 missense probably damaging 1.00
R0278:Lin9 UTSW 1 180665923 missense probably damaging 1.00
R1488:Lin9 UTSW 1 180688285 missense possibly damaging 0.61
R3808:Lin9 UTSW 1 180659111 missense probably null 0.32
R3809:Lin9 UTSW 1 180659111 missense probably null 0.32
R3884:Lin9 UTSW 1 180688065 nonsense probably null
R3978:Lin9 UTSW 1 180668792 missense possibly damaging 0.94
R4600:Lin9 UTSW 1 180681194 missense probably damaging 0.99
R4625:Lin9 UTSW 1 180689280 missense probably damaging 0.99
R4730:Lin9 UTSW 1 180665851 nonsense probably null
R4987:Lin9 UTSW 1 180668764 missense probably damaging 1.00
R5034:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5035:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5045:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5046:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5180:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5181:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5221:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5222:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5329:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5332:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5633:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5634:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5696:Lin9 UTSW 1 180659081 missense probably benign 0.00
R5812:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5813:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5814:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5851:Lin9 UTSW 1 180669198 missense probably benign 0.01
R7046:Lin9 UTSW 1 180667370 missense probably damaging 1.00
R7084:Lin9 UTSW 1 180688096 missense probably benign 0.11
Z1177:Lin9 UTSW 1 180650802 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTACTTCAGGACTTGAGCTAC -3'
(R):5'- TGGAAATAGCAGAGTCCTGAAAACC -3'

Sequencing Primer
(F):5'- CAGGACTTGAGCTACCAATATTATG -3'
(R):5'- GAGTCCTGAAAACCCACATAGTG -3'
Posted On2016-06-21