Mutagenetix > Incidental Mutation

Incidental Mutation 'R5148:Lin9'

395183

Institutional Source

Beutler Lab

Gene Symbol

Lin9

Ensembl Gene

ENSMUSG00000058729

Gene Name

lin-9 homolog (C. elegans)

Synonyms

2700022J23Rik

MMRRC Submission

043262-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5148 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

180641150-180690694 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 180669198 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 351 (L351I)

Ref Sequence

ENSEMBL: ENSMUSP00000141331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000192561] [ENSMUST00000192725] [ENSMUST00000193892]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000085803
AA Change: L335I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000082959
Gene: ENSMUSG00000058729
AA Change: L335I

Domain	Start	End	E-Value	Type
DIRP	127	232	2.93e-67	SMART
coiled coil region	354	412	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000085804

SMART Domains

Protein: ENSMUSP00000082960
Gene: ENSMUSG00000058729

Domain	Start	End	E-Value	Type
DIRP	127	232	2.93e-67	SMART
coiled coil region	354	412	N/A	INTRINSIC
transmembrane domain	416	438	N/A	INTRINSIC
low complexity region	445	458	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191744

Predicted Effect

probably benign
Transcript: ENSMUST00000192561
AA Change: L351I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000141331
Gene: ENSMUSG00000058729
AA Change: L351I

Domain	Start	End	E-Value	Type
DIRP	143	248	2.2e-71	SMART
coiled coil region	370	428	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192725
AA Change: L311I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000141503
Gene: ENSMUSG00000058729
AA Change: L311I

Domain	Start	End	E-Value	Type
DIRP	103	208	2.2e-71	SMART
coiled coil region	330	388	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193892

SMART Domains

Protein: ENSMUSP00000141530
Gene: ENSMUSG00000058729

Domain	Start	End	E-Value	Type
DIRP	127	232	2.2e-71	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000194638

Meta Mutation Damage Score

0.0673

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that inhibits DNA synthesis and oncogenic transformation through association with the retinoblastoma 1 protein. The encoded protein also interacts with a complex of other cell cycle regulators to repress cell cycle-dependent gene expression in non-dividing cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show increased body weight. Mice homozygous for a gene-trap allele die shortly after implantation with defects in early embryogenesis. Homozygous deletion in adult mice causes premature death, intestinal epithelium atrophy, and abnormal mitosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank2	A	T	3: 127,025,636		probably null	Het
Atf7	A	G	15: 102,547,173	M252T	probably benign	Het
Cacna1h	C	A	17: 25,387,545	D1027Y	probably damaging	Het
Cngb1	A	G	8: 95,265,983	V667A	probably benign	Het
Cntf	T	C	19: 12,764,004	E164G	probably damaging	Het
Dbt	T	C	3: 116,528,244		probably benign	Het
Egfem1	G	A	3: 29,457,823		probably benign	Het
Gm12790	C	T	4: 101,968,071	V49I	possibly damaging	Het
Gm5444	C	T	13: 4,834,315		noncoding transcript	Het
Gpcpd1	A	T	2: 132,534,190	Y574*	probably null	Het
Gss	G	T	2: 155,573,109	N225K	possibly damaging	Het
Il17rc	G	T	6: 113,482,997	A635S	probably benign	Het
Lhfpl5	T	A	17: 28,579,968	D150E	probably damaging	Het
Lrrc40	T	G	3: 158,054,569		probably null	Het
Ly6f	A	G	15: 75,271,797	T118A	probably benign	Het
Malrd1	A	G	2: 16,142,226	N1960D	unknown	Het
Map3k14	T	C	11: 103,239,332	H253R	probably benign	Het
Morc2a	T	C	11: 3,689,084	L1025P	probably damaging	Het
Nlrc5	G	T	8: 94,476,693	G474W	probably damaging	Het
Olfr1162	G	A	2: 88,050,393	T77I	probably benign	Het
Olfr1487	C	A	19: 13,619,510	S116*	probably null	Het
Olfr894	T	C	9: 38,219,021	I66T	probably benign	Het
Olr1	G	T	6: 129,493,609	D198E	probably benign	Het
Pafah1b1	A	T	11: 74,684,452	S209T	probably damaging	Het
Phf14	A	T	6: 11,961,642	Y426F	possibly damaging	Het
Phldb1	A	G	9: 44,704,158	V855A	probably benign	Het
Pira2	T	G	7: 3,844,593	R32S	possibly damaging	Het
Pnldc1	T	C	17: 12,892,789	I344V	probably benign	Het
Prss29	T	C	17: 25,320,907	V93A	probably benign	Het
Ptpn13	C	T	5: 103,492,232	L186F	probably damaging	Het
Ralgps1	A	C	2: 33,158,987	C303W	probably damaging	Het
Sdr42e1	T	A	8: 117,663,603	N100Y	probably damaging	Het
Serpina11	A	T	12: 103,986,244	L96Q	probably damaging	Het
Slc12a8	G	A	16: 33,624,918	R448H	probably benign	Het
Snrpd1	T	A	18: 10,626,892	V53E	probably benign	Het
Ssbp1	T	C	6: 40,477,949	V114A	possibly damaging	Het
T	A	G	17: 8,436,205	E47G	probably damaging	Het
Tmem156	T	C	5: 65,073,768	K189R	probably benign	Het
Trim47	G	T	11: 116,107,852	Q314K	possibly damaging	Het
Vmn2r3	G	T	3: 64,278,826	P146Q	probably damaging	Het
Vmn2r6	A	C	3: 64,556,594	V273G	probably damaging	Het
Wrnip1	G	T	13: 32,806,856	R366L	probably damaging	Het
Zfp981	A	T	4: 146,536,900	H94L	possibly damaging	Het

Other mutations in Lin9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02220:Lin9	APN	1	180667367	missense	probably damaging	1.00
IGL02221:Lin9	APN	1	180650834	missense	probably benign	0.03
IGL02233:Lin9	APN	1	180689300	missense	probably damaging	0.98
IGL02370:Lin9	APN	1	180688018	missense	probably damaging	1.00
IGL02794:Lin9	APN	1	180651879	missense	probably damaging	1.00
grosbeak	UTSW	1	180668885	critical splice donor site	probably null
linnet	UTSW	1	180669198	missense	probably benign	0.01
R0278:Lin9	UTSW	1	180665923	missense	probably damaging	1.00
R1488:Lin9	UTSW	1	180688285	missense	possibly damaging	0.61
R3808:Lin9	UTSW	1	180659111	missense	probably null	0.32
R3809:Lin9	UTSW	1	180659111	missense	probably null	0.32
R3884:Lin9	UTSW	1	180688065	nonsense	probably null
R3978:Lin9	UTSW	1	180668792	missense	possibly damaging	0.94
R4600:Lin9	UTSW	1	180681194	missense	probably damaging	0.99
R4625:Lin9	UTSW	1	180689280	missense	probably damaging	0.99
R4730:Lin9	UTSW	1	180665851	nonsense	probably null
R4987:Lin9	UTSW	1	180668764	missense	probably damaging	1.00
R5034:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5035:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5045:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5046:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5180:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5181:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5221:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5222:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5329:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5332:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5633:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5634:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5696:Lin9	UTSW	1	180659081	missense	probably benign	0.00
R5812:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5813:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5814:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5851:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R7046:Lin9	UTSW	1	180667370	missense	probably damaging	1.00
R7084:Lin9	UTSW	1	180688096	missense	probably benign	0.11
R8163:Lin9	UTSW	1	180659126	missense	probably damaging	1.00
R8421:Lin9	UTSW	1	180665800	missense	probably damaging	1.00
R8776:Lin9	UTSW	1	180668885	critical splice donor site	probably null
R8776-TAIL:Lin9	UTSW	1	180668885	critical splice donor site	probably null
R9264:Lin9	UTSW	1	180667347	missense	probably damaging	0.99
R9283:Lin9	UTSW	1	180665928	missense	probably damaging	1.00
Z1177:Lin9	UTSW	1	180650802	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- GCTACTTCAGGACTTGAGCTAC -3'
(R):5'- TGGAAATAGCAGAGTCCTGAAAACC -3'

Sequencing Primer
(F):5'- CAGGACTTGAGCTACCAATATTATG -3'
(R):5'- GAGTCCTGAAAACCCACATAGTG -3'

Posted On

2016-06-21