Incidental Mutation 'R5148:Gpcpd1'
ID395187
Institutional Source Beutler Lab
Gene Symbol Gpcpd1
Ensembl Gene ENSMUSG00000027346
Gene Nameglycerophosphocholine phosphodiesterase 1
Synonyms2310004G06Rik, 2310032D16Rik, Prei4
MMRRC Submission 043262-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R5148 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location132529082-132587729 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 132534190 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 574 (Y574*)
Ref Sequence ENSEMBL: ENSMUSP00000105769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028822] [ENSMUST00000060955] [ENSMUST00000110136] [ENSMUST00000110142] [ENSMUST00000145694] [ENSMUST00000148833] [ENSMUST00000149854]
Predicted Effect probably null
Transcript: ENSMUST00000028822
AA Change: Y390*
SMART Domains Protein: ENSMUSP00000028822
Gene: ENSMUSG00000027346
AA Change: Y390*

DomainStartEndE-ValueType
Pfam:GDPD 142 432 1.3e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000060955
AA Change: Y574*
SMART Domains Protein: ENSMUSP00000062221
Gene: ENSMUSG00000027346
AA Change: Y574*

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
low complexity region 142 160 N/A INTRINSIC
low complexity region 167 175 N/A INTRINSIC
Pfam:GDPD 326 615 5.3e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110136
AA Change: Y390*
SMART Domains Protein: ENSMUSP00000105763
Gene: ENSMUSG00000027346
AA Change: Y390*

DomainStartEndE-ValueType
Pfam:GDPD 142 431 4.1e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110142
AA Change: Y574*
SMART Domains Protein: ENSMUSP00000105769
Gene: ENSMUSG00000027346
AA Change: Y574*

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
low complexity region 142 160 N/A INTRINSIC
low complexity region 167 175 N/A INTRINSIC
Pfam:GDPD 326 615 6.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127712
Predicted Effect probably benign
Transcript: ENSMUST00000145694
SMART Domains Protein: ENSMUSP00000116457
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148833
SMART Domains Protein: ENSMUSP00000116156
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 99 1.02e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149854
SMART Domains Protein: ENSMUSP00000116949
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 94 5.54e-13 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 A T 3: 127,025,636 probably null Het
Atf7 A G 15: 102,547,173 M252T probably benign Het
Cacna1h C A 17: 25,387,545 D1027Y probably damaging Het
Cngb1 A G 8: 95,265,983 V667A probably benign Het
Cntf T C 19: 12,764,004 E164G probably damaging Het
Dbt T C 3: 116,528,244 probably benign Het
Egfem1 G A 3: 29,457,823 probably benign Het
Gm12790 C T 4: 101,968,071 V49I possibly damaging Het
Gm5444 C T 13: 4,834,315 noncoding transcript Het
Gss G T 2: 155,573,109 N225K possibly damaging Het
Il17rc G T 6: 113,482,997 A635S probably benign Het
Lhfpl5 T A 17: 28,579,968 D150E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc40 T G 3: 158,054,569 probably null Het
Ly6f A G 15: 75,271,797 T118A probably benign Het
Malrd1 A G 2: 16,142,226 N1960D unknown Het
Map3k14 T C 11: 103,239,332 H253R probably benign Het
Morc2a T C 11: 3,689,084 L1025P probably damaging Het
Nlrc5 G T 8: 94,476,693 G474W probably damaging Het
Olfr1162 G A 2: 88,050,393 T77I probably benign Het
Olfr1487 C A 19: 13,619,510 S116* probably null Het
Olfr894 T C 9: 38,219,021 I66T probably benign Het
Olr1 G T 6: 129,493,609 D198E probably benign Het
Pafah1b1 A T 11: 74,684,452 S209T probably damaging Het
Phf14 A T 6: 11,961,642 Y426F possibly damaging Het
Phldb1 A G 9: 44,704,158 V855A probably benign Het
Pira2 T G 7: 3,844,593 R32S possibly damaging Het
Pnldc1 T C 17: 12,892,789 I344V probably benign Het
Prss29 T C 17: 25,320,907 V93A probably benign Het
Ptpn13 C T 5: 103,492,232 L186F probably damaging Het
Ralgps1 A C 2: 33,158,987 C303W probably damaging Het
Sdr42e1 T A 8: 117,663,603 N100Y probably damaging Het
Serpina11 A T 12: 103,986,244 L96Q probably damaging Het
Slc12a8 G A 16: 33,624,918 R448H probably benign Het
Snrpd1 T A 18: 10,626,892 V53E probably benign Het
Ssbp1 T C 6: 40,477,949 V114A possibly damaging Het
T A G 17: 8,436,205 E47G probably damaging Het
Tmem156 T C 5: 65,073,768 K189R probably benign Het
Trim47 G T 11: 116,107,852 Q314K possibly damaging Het
Vmn2r3 G T 3: 64,278,826 P146Q probably damaging Het
Vmn2r6 A C 3: 64,556,594 V273G probably damaging Het
Wrnip1 G T 13: 32,806,856 R366L probably damaging Het
Zfp981 A T 4: 146,536,900 H94L possibly damaging Het
Other mutations in Gpcpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Gpcpd1 APN 2 132556983 splice site probably null
IGL00672:Gpcpd1 APN 2 132530548 utr 3 prime probably benign
IGL00676:Gpcpd1 APN 2 132554011 missense probably damaging 1.00
IGL00832:Gpcpd1 APN 2 132546850 missense probably damaging 1.00
IGL00931:Gpcpd1 APN 2 132538118 missense probably benign 0.00
IGL01309:Gpcpd1 APN 2 132550324 missense probably damaging 0.97
IGL01960:Gpcpd1 APN 2 132539898 critical splice donor site probably null
IGL02110:Gpcpd1 APN 2 132530610 nonsense probably null
IGL02267:Gpcpd1 APN 2 132568710 missense probably damaging 1.00
IGL02570:Gpcpd1 APN 2 132547685 missense probably benign 0.01
IGL02588:Gpcpd1 APN 2 132534753 missense probably damaging 1.00
IGL03306:Gpcpd1 APN 2 132534073 critical splice donor site probably null
Baependi UTSW 2 132544435 missense probably damaging 1.00
R0413:Gpcpd1 UTSW 2 132564623 splice site probably benign
R1876:Gpcpd1 UTSW 2 132534753 missense probably damaging 1.00
R4276:Gpcpd1 UTSW 2 132540287 missense probably damaging 0.99
R4571:Gpcpd1 UTSW 2 132550350 missense probably benign 0.05
R4849:Gpcpd1 UTSW 2 132534099 missense probably damaging 1.00
R4930:Gpcpd1 UTSW 2 132546874 missense probably damaging 1.00
R5060:Gpcpd1 UTSW 2 132544435 missense probably damaging 1.00
R5081:Gpcpd1 UTSW 2 132547702 missense probably benign 0.17
R5189:Gpcpd1 UTSW 2 132553972 missense probably damaging 1.00
R5344:Gpcpd1 UTSW 2 132558677 intron probably benign
R5623:Gpcpd1 UTSW 2 132534717 missense probably damaging 1.00
R6086:Gpcpd1 UTSW 2 132538114 missense probably damaging 1.00
R6787:Gpcpd1 UTSW 2 132537838 intron probably benign
R6885:Gpcpd1 UTSW 2 132554074 missense possibly damaging 0.56
R7223:Gpcpd1 UTSW 2 132534056 missense probably benign 0.00
R7261:Gpcpd1 UTSW 2 132568699 missense probably damaging 0.97
R7900:Gpcpd1 UTSW 2 132534739 missense probably damaging 0.99
R8120:Gpcpd1 UTSW 2 132554023 missense probably damaging 1.00
R8494:Gpcpd1 UTSW 2 132544435 missense probably damaging 0.97
X0018:Gpcpd1 UTSW 2 132534769 missense probably damaging 1.00
X0060:Gpcpd1 UTSW 2 132534781 missense probably damaging 1.00
X0066:Gpcpd1 UTSW 2 132544395 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ATCTGGGACAAGATCACAAGTGTC -3'
(R):5'- AACAACTGGCAAAAGGTTTAGC -3'

Sequencing Primer
(F):5'- ACAAGATCACAAGTGTCTGAATAAAC -3'
(R):5'- ACTGGCAAAAGGTTTAGCTAATATC -3'
Posted On2016-06-21