Incidental Mutation 'R5148:Gss'
ID395188
Institutional Source Beutler Lab
Gene Symbol Gss
Ensembl Gene ENSMUSG00000027610
Gene Nameglutathione synthetase
SynonymsGS-A/GS-B
MMRRC Submission 043262-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5148 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155563181-155592810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 155573109 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 225 (N225K)
Ref Sequence ENSEMBL: ENSMUSP00000078630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065973] [ENSMUST00000079691] [ENSMUST00000126322] [ENSMUST00000130881] [ENSMUST00000155347]
Predicted Effect probably benign
Transcript: ENSMUST00000065973
SMART Domains Protein: ENSMUSP00000068776
Gene: ENSMUSG00000027605

DomainStartEndE-ValueType
Pfam:AMP-binding 108 575 4.8e-98 PFAM
Pfam:AMP-binding_C 583 660 3.1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000079691
AA Change: N225K

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078630
Gene: ENSMUSG00000027610
AA Change: N225K

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 12 472 6.7e-131 PFAM
Pfam:GSH_synthase 204 302 2.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126322
AA Change: N183K

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117266
Gene: ENSMUSG00000027610
AA Change: N183K

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 1 197 1.2e-63 PFAM
Pfam:GSH_synthase 160 200 3.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130881
AA Change: N156K

PolyPhen 2 Score 0.609 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135319
Gene: ENSMUSG00000027610
AA Change: N156K

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 1 404 9.2e-130 PFAM
Pfam:GSH_synthase 133 233 9e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153975
Predicted Effect probably benign
Transcript: ENSMUST00000155347
SMART Domains Protein: ENSMUSP00000122662
Gene: ENSMUSG00000027610

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 5 179 1.8e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157008
Predicted Effect probably benign
Transcript: ENSMUST00000175993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176415
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutathione is important for a variety of biological functions, including protection of cells from oxidative damage by free radicals, detoxification of xenobiotics, and membrane transport. The protein encoded by this gene functions as a homodimer to catalyze the second step of glutathione biosynthesis, which is the ATP-dependent conversion of gamma-L-glutamyl-L-cysteine to glutathione. Defects in this gene are a cause of glutathione synthetase deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation all die before E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 A T 3: 127,025,636 probably null Het
Atf7 A G 15: 102,547,173 M252T probably benign Het
Cacna1h C A 17: 25,387,545 D1027Y probably damaging Het
Cngb1 A G 8: 95,265,983 V667A probably benign Het
Cntf T C 19: 12,764,004 E164G probably damaging Het
Dbt T C 3: 116,528,244 probably benign Het
Egfem1 G A 3: 29,457,823 probably benign Het
Gm12790 C T 4: 101,968,071 V49I possibly damaging Het
Gm5444 C T 13: 4,834,315 noncoding transcript Het
Gpcpd1 A T 2: 132,534,190 Y574* probably null Het
Il17rc G T 6: 113,482,997 A635S probably benign Het
Lhfpl5 T A 17: 28,579,968 D150E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc40 T G 3: 158,054,569 probably null Het
Ly6f A G 15: 75,271,797 T118A probably benign Het
Malrd1 A G 2: 16,142,226 N1960D unknown Het
Map3k14 T C 11: 103,239,332 H253R probably benign Het
Morc2a T C 11: 3,689,084 L1025P probably damaging Het
Nlrc5 G T 8: 94,476,693 G474W probably damaging Het
Olfr1162 G A 2: 88,050,393 T77I probably benign Het
Olfr1487 C A 19: 13,619,510 S116* probably null Het
Olfr894 T C 9: 38,219,021 I66T probably benign Het
Olr1 G T 6: 129,493,609 D198E probably benign Het
Pafah1b1 A T 11: 74,684,452 S209T probably damaging Het
Phf14 A T 6: 11,961,642 Y426F possibly damaging Het
Phldb1 A G 9: 44,704,158 V855A probably benign Het
Pira2 T G 7: 3,844,593 R32S possibly damaging Het
Pnldc1 T C 17: 12,892,789 I344V probably benign Het
Prss29 T C 17: 25,320,907 V93A probably benign Het
Ptpn13 C T 5: 103,492,232 L186F probably damaging Het
Ralgps1 A C 2: 33,158,987 C303W probably damaging Het
Sdr42e1 T A 8: 117,663,603 N100Y probably damaging Het
Serpina11 A T 12: 103,986,244 L96Q probably damaging Het
Slc12a8 G A 16: 33,624,918 R448H probably benign Het
Snrpd1 T A 18: 10,626,892 V53E probably benign Het
Ssbp1 T C 6: 40,477,949 V114A possibly damaging Het
T A G 17: 8,436,205 E47G probably damaging Het
Tmem156 T C 5: 65,073,768 K189R probably benign Het
Trim47 G T 11: 116,107,852 Q314K possibly damaging Het
Vmn2r3 G T 3: 64,278,826 P146Q probably damaging Het
Vmn2r6 A C 3: 64,556,594 V273G probably damaging Het
Wrnip1 G T 13: 32,806,856 R366L probably damaging Het
Zfp981 A T 4: 146,536,900 H94L possibly damaging Het
Other mutations in Gss
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Gss APN 2 155581951 missense probably damaging 1.00
IGL01737:Gss APN 2 155567806 missense probably damaging 1.00
IGL01783:Gss APN 2 155571559 missense probably damaging 1.00
IGL02329:Gss APN 2 155567853 missense probably benign 0.01
IGL02386:Gss APN 2 155573170 missense probably benign 0.01
IGL02948:Gss APN 2 155577621 missense probably damaging 1.00
PIT4515001:Gss UTSW 2 155578341 missense probably damaging 1.00
R0230:Gss UTSW 2 155578406 missense probably damaging 1.00
R0446:Gss UTSW 2 155567745 missense probably benign 0.00
R0931:Gss UTSW 2 155567689 intron probably benign
R1396:Gss UTSW 2 155567721 missense probably damaging 0.99
R2896:Gss UTSW 2 155564829 missense probably damaging 1.00
R2986:Gss UTSW 2 155587443 missense probably benign 0.21
R4852:Gss UTSW 2 155564865 missense probably benign 0.06
R6017:Gss UTSW 2 155587465 missense probably benign
R6574:Gss UTSW 2 155582011 missense probably damaging 1.00
R6868:Gss UTSW 2 155567812 missense possibly damaging 0.69
R8274:Gss UTSW 2 155587504 missense probably benign 0.00
R8510:Gss UTSW 2 155567824 nonsense probably null
R8801:Gss UTSW 2 155564766 missense probably damaging 1.00
R8903:Gss UTSW 2 155578359 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGGCTCTTAATCCAGCTGTC -3'
(R):5'- GCCAGCAGGACTACTTGAGAAG -3'

Sequencing Primer
(F):5'- GGGGATGCTTACATAAACAGCCTTC -3'
(R):5'- GACTACTTGAGAAGCTGTGTTCTCAC -3'
Posted On2016-06-21