Incidental Mutation 'R5148:Phldb1'
ID395207
Institutional Source Beutler Lab
Gene Symbol Phldb1
Ensembl Gene ENSMUSG00000048537
Gene Namepleckstrin homology like domain, family B, member 1
SynonymsLL5A, D330037A14Rik
MMRRC Submission 043262-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5148 (G1)
Quality Score224
Status Validated
Chromosome9
Chromosomal Location44686304-44735198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44704158 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 855 (V855A)
Ref Sequence ENSEMBL: ENSMUSP00000120208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034611] [ENSMUST00000123310] [ENSMUST00000134465] [ENSMUST00000135436] [ENSMUST00000138356] [ENSMUST00000144251] [ENSMUST00000147495] [ENSMUST00000154723] [ENSMUST00000156918]
Predicted Effect probably benign
Transcript: ENSMUST00000034611
AA Change: V855A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034611
Gene: ENSMUSG00000048537
AA Change: V855A

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5.01e-5 PROSPERO
internal_repeat_1 401 449 5.01e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1366 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123123
Predicted Effect probably benign
Transcript: ENSMUST00000123310
SMART Domains Protein: ENSMUSP00000122374
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 58 79 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 185 193 N/A INTRINSIC
coiled coil region 232 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128326
AA Change: V347A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119966
Gene: ENSMUSG00000048537
AA Change: V347A

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
low complexity region 312 322 N/A INTRINSIC
coiled coil region 357 396 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 493 506 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 564 572 N/A INTRINSIC
coiled coil region 610 679 N/A INTRINSIC
PH 723 827 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134465
AA Change: V855A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117395
Gene: ENSMUSG00000048537
AA Change: V855A

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 8e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 6.75e-5 PROSPERO
internal_repeat_1 401 449 6.75e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 929 950 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
coiled coil region 1103 1172 N/A INTRINSIC
PH 1215 1319 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135436
SMART Domains Protein: ENSMUSP00000120023
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
coiled coil region 274 343 N/A INTRINSIC
PH 386 490 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138356
AA Change: V855A

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000120208
Gene: ENSMUSG00000048537
AA Change: V855A

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 4.93e-5 PROSPERO
internal_repeat_1 401 449 4.93e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 931 948 N/A INTRINSIC
low complexity region 999 1017 N/A INTRINSIC
low complexity region 1032 1053 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
low complexity region 1159 1167 N/A INTRINSIC
coiled coil region 1206 1286 N/A INTRINSIC
PH 1329 1444 6.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144251
AA Change: V215A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114773
Gene: ENSMUSG00000048537
AA Change: V215A

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
coiled coil region 146 174 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
coiled coil region 225 264 N/A INTRINSIC
low complexity region 289 310 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
low complexity region 416 424 N/A INTRINSIC
coiled coil region 463 532 N/A INTRINSIC
PH 575 679 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147495
AA Change: V855A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122661
Gene: ENSMUSG00000048537
AA Change: V855A

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5e-5 PROSPERO
internal_repeat_1 401 449 5e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1377 6.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148344
AA Change: V599A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121809
Gene: ENSMUSG00000048537
AA Change: V599A

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 41 61 N/A INTRINSIC
internal_repeat_1 66 99 6.7e-6 PROSPERO
internal_repeat_1 146 194 6.7e-6 PROSPERO
low complexity region 204 222 N/A INTRINSIC
low complexity region 335 362 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
coiled coil region 459 542 N/A INTRINSIC
low complexity region 564 574 N/A INTRINSIC
coiled coil region 609 648 N/A INTRINSIC
low complexity region 688 706 N/A INTRINSIC
low complexity region 721 742 N/A INTRINSIC
low complexity region 792 805 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 863 871 N/A INTRINSIC
coiled coil region 909 978 N/A INTRINSIC
PH 1022 1126 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154723
AA Change: V108A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116987
Gene: ENSMUSG00000048537
AA Change: V108A

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
coiled coil region 118 157 N/A INTRINSIC
low complexity region 197 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156918
AA Change: V172A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120092
Gene: ENSMUSG00000048537
AA Change: V172A

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
low complexity region 136 146 N/A INTRINSIC
coiled coil region 182 221 N/A INTRINSIC
low complexity region 246 267 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
low complexity region 373 381 N/A INTRINSIC
coiled coil region 420 489 N/A INTRINSIC
PH 532 636 1.31e-17 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 A T 3: 127,025,636 probably null Het
Atf7 A G 15: 102,547,173 M252T probably benign Het
Cacna1h C A 17: 25,387,545 D1027Y probably damaging Het
Cngb1 A G 8: 95,265,983 V667A probably benign Het
Cntf T C 19: 12,764,004 E164G probably damaging Het
Dbt T C 3: 116,528,244 probably benign Het
Egfem1 G A 3: 29,457,823 probably benign Het
Gm12790 C T 4: 101,968,071 V49I possibly damaging Het
Gm5444 C T 13: 4,834,315 noncoding transcript Het
Gpcpd1 A T 2: 132,534,190 Y574* probably null Het
Gss G T 2: 155,573,109 N225K possibly damaging Het
Il17rc G T 6: 113,482,997 A635S probably benign Het
Lhfpl5 T A 17: 28,579,968 D150E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc40 T G 3: 158,054,569 probably null Het
Ly6f A G 15: 75,271,797 T118A probably benign Het
Malrd1 A G 2: 16,142,226 N1960D unknown Het
Map3k14 T C 11: 103,239,332 H253R probably benign Het
Morc2a T C 11: 3,689,084 L1025P probably damaging Het
Nlrc5 G T 8: 94,476,693 G474W probably damaging Het
Olfr1162 G A 2: 88,050,393 T77I probably benign Het
Olfr1487 C A 19: 13,619,510 S116* probably null Het
Olfr894 T C 9: 38,219,021 I66T probably benign Het
Olr1 G T 6: 129,493,609 D198E probably benign Het
Pafah1b1 A T 11: 74,684,452 S209T probably damaging Het
Phf14 A T 6: 11,961,642 Y426F possibly damaging Het
Pira2 T G 7: 3,844,593 R32S possibly damaging Het
Pnldc1 T C 17: 12,892,789 I344V probably benign Het
Prss29 T C 17: 25,320,907 V93A probably benign Het
Ptpn13 C T 5: 103,492,232 L186F probably damaging Het
Ralgps1 A C 2: 33,158,987 C303W probably damaging Het
Sdr42e1 T A 8: 117,663,603 N100Y probably damaging Het
Serpina11 A T 12: 103,986,244 L96Q probably damaging Het
Slc12a8 G A 16: 33,624,918 R448H probably benign Het
Snrpd1 T A 18: 10,626,892 V53E probably benign Het
Ssbp1 T C 6: 40,477,949 V114A possibly damaging Het
T A G 17: 8,436,205 E47G probably damaging Het
Tmem156 T C 5: 65,073,768 K189R probably benign Het
Trim47 G T 11: 116,107,852 Q314K possibly damaging Het
Vmn2r3 G T 3: 64,278,826 P146Q probably damaging Het
Vmn2r6 A C 3: 64,556,594 V273G probably damaging Het
Wrnip1 G T 13: 32,806,856 R366L probably damaging Het
Zfp981 A T 4: 146,536,900 H94L possibly damaging Het
Other mutations in Phldb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Phldb1 APN 9 44711146 critical splice donor site probably null
IGL01089:Phldb1 APN 9 44707887 nonsense probably null
IGL01374:Phldb1 APN 9 44696167 missense probably damaging 0.98
IGL01654:Phldb1 APN 9 44718357 splice site probably null
IGL02148:Phldb1 APN 9 44696072 missense probably damaging 0.99
IGL02408:Phldb1 APN 9 44715906 missense possibly damaging 0.50
IGL02429:Phldb1 APN 9 44700950 missense probably damaging 1.00
IGL02440:Phldb1 APN 9 44715403 missense probably damaging 0.99
IGL02457:Phldb1 APN 9 44716474 missense probably benign 0.00
IGL02471:Phldb1 APN 9 44711233 missense probably damaging 1.00
IGL02506:Phldb1 APN 9 44710926 missense probably benign 0.00
IGL03335:Phldb1 APN 9 44728069 missense possibly damaging 0.95
PIT4515001:Phldb1 UTSW 9 44715960 missense probably benign 0.00
R0070:Phldb1 UTSW 9 44707904 missense probably damaging 1.00
R0117:Phldb1 UTSW 9 44711706 start codon destroyed probably null
R0344:Phldb1 UTSW 9 44701667 missense probably benign 0.14
R0364:Phldb1 UTSW 9 44699335 splice site probably benign
R0622:Phldb1 UTSW 9 44715852 missense probably damaging 1.00
R0737:Phldb1 UTSW 9 44699636 missense possibly damaging 0.92
R1449:Phldb1 UTSW 9 44716633 missense probably benign 0.17
R1498:Phldb1 UTSW 9 44701618 missense possibly damaging 0.70
R1633:Phldb1 UTSW 9 44718322 missense probably damaging 1.00
R1647:Phldb1 UTSW 9 44715433 missense probably damaging 1.00
R1692:Phldb1 UTSW 9 44715420 missense probably damaging 1.00
R1749:Phldb1 UTSW 9 44715748 missense probably damaging 1.00
R1797:Phldb1 UTSW 9 44716545 missense probably damaging 0.99
R2012:Phldb1 UTSW 9 44728036 missense possibly damaging 0.67
R2078:Phldb1 UTSW 9 44707979 missense probably damaging 1.00
R2208:Phldb1 UTSW 9 44696131 missense probably damaging 1.00
R2567:Phldb1 UTSW 9 44726025 missense probably damaging 0.99
R2696:Phldb1 UTSW 9 44718288 missense probably damaging 1.00
R3705:Phldb1 UTSW 9 44694394 missense probably damaging 0.97
R4110:Phldb1 UTSW 9 44715831 missense possibly damaging 0.88
R4772:Phldb1 UTSW 9 44711027 missense probably damaging 1.00
R4857:Phldb1 UTSW 9 44696092 missense probably damaging 0.99
R5651:Phldb1 UTSW 9 44711903 missense probably damaging 1.00
R5666:Phldb1 UTSW 9 44715781 missense probably damaging 0.97
R5670:Phldb1 UTSW 9 44715781 missense probably damaging 0.97
R5914:Phldb1 UTSW 9 44711651 missense probably damaging 0.97
R6232:Phldb1 UTSW 9 44696117 missense probably damaging 1.00
R6257:Phldb1 UTSW 9 44696140 missense probably damaging 0.99
R6413:Phldb1 UTSW 9 44696143 missense probably damaging 1.00
R6418:Phldb1 UTSW 9 44711900 missense probably damaging 1.00
R6813:Phldb1 UTSW 9 44699568 missense probably damaging 1.00
R6845:Phldb1 UTSW 9 44716062 missense probably damaging 1.00
R7009:Phldb1 UTSW 9 44694408 missense probably damaging 1.00
R7042:Phldb1 UTSW 9 44694424 missense probably damaging 1.00
R7062:Phldb1 UTSW 9 44696135 missense probably damaging 0.99
R7077:Phldb1 UTSW 9 44711904 missense possibly damaging 0.62
R7307:Phldb1 UTSW 9 44694047 missense possibly damaging 0.62
R7995:Phldb1 UTSW 9 44715372 missense probably damaging 1.00
R8108:Phldb1 UTSW 9 44711161 missense probably damaging 1.00
R8433:Phldb1 UTSW 9 44716462 missense probably damaging 1.00
RF020:Phldb1 UTSW 9 44697946 missense probably damaging 1.00
X0020:Phldb1 UTSW 9 44687677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGGTCTTCGGAAAAGGC -3'
(R):5'- AGGAATTGATCTCCTTAGCCAG -3'

Sequencing Primer
(F):5'- GAGCGAATGGTATCTCCTCTCAAG -3'
(R):5'- CTTAGCCAGAATTCTCCTGGGG -3'
Posted On2016-06-21