Incidental Mutation 'R5148:Morc2a'
ID395208
Institutional Source Beutler Lab
Gene Symbol Morc2a
Ensembl Gene ENSMUSG00000034543
Gene Namemicrorchidia 2A
SynonymsZcwcc1, 8430403M08Rik
MMRRC Submission 043262-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5148 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location3649494-3690477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3689084 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1025 (L1025P)
Ref Sequence ENSEMBL: ENSMUSP00000094176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093389] [ENSMUST00000096441]
Predicted Effect probably damaging
Transcript: ENSMUST00000093389
AA Change: L1025P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091087
Gene: ENSMUSG00000034543
AA Change: L1025P

DomainStartEndE-ValueType
HATPase_c 24 134 5.35e0 SMART
coiled coil region 285 322 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Pfam:zf-CW 495 542 5.1e-18 PFAM
coiled coil region 555 583 N/A INTRINSIC
low complexity region 600 618 N/A INTRINSIC
low complexity region 678 704 N/A INTRINSIC
low complexity region 714 729 N/A INTRINSIC
coiled coil region 742 776 N/A INTRINSIC
coiled coil region 966 1011 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000096441
AA Change: L1025P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094176
Gene: ENSMUSG00000034543
AA Change: L1025P

DomainStartEndE-ValueType
HATPase_c 24 134 5.35e0 SMART
coiled coil region 285 322 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Pfam:zf-CW 494 543 1.7e-19 PFAM
coiled coil region 555 583 N/A INTRINSIC
low complexity region 600 618 N/A INTRINSIC
low complexity region 678 704 N/A INTRINSIC
low complexity region 714 729 N/A INTRINSIC
coiled coil region 742 776 N/A INTRINSIC
coiled coil region 966 1011 N/A INTRINSIC
Meta Mutation Damage Score 0.9288 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Microrchidia (MORC) protein superfamily. The encoded protein is known to regulate the condensation of heterochromatin in response to DNA damage and play a role in repressing transcription. The protein has been found to regulate the activity of ATP citrate lyase via specific interaction with this enzyme in the cytosol of lipogenic breast cancer cells. The protein also plays a role in lipogenesis and adipocyte differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 A T 3: 127,025,636 probably null Het
Atf7 A G 15: 102,547,173 M252T probably benign Het
Cacna1h C A 17: 25,387,545 D1027Y probably damaging Het
Cngb1 A G 8: 95,265,983 V667A probably benign Het
Cntf T C 19: 12,764,004 E164G probably damaging Het
Dbt T C 3: 116,528,244 probably benign Het
Egfem1 G A 3: 29,457,823 probably benign Het
Gm12790 C T 4: 101,968,071 V49I possibly damaging Het
Gm5444 C T 13: 4,834,315 noncoding transcript Het
Gpcpd1 A T 2: 132,534,190 Y574* probably null Het
Gss G T 2: 155,573,109 N225K possibly damaging Het
Il17rc G T 6: 113,482,997 A635S probably benign Het
Lhfpl5 T A 17: 28,579,968 D150E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc40 T G 3: 158,054,569 probably null Het
Ly6f A G 15: 75,271,797 T118A probably benign Het
Malrd1 A G 2: 16,142,226 N1960D unknown Het
Map3k14 T C 11: 103,239,332 H253R probably benign Het
Nlrc5 G T 8: 94,476,693 G474W probably damaging Het
Olfr1162 G A 2: 88,050,393 T77I probably benign Het
Olfr1487 C A 19: 13,619,510 S116* probably null Het
Olfr894 T C 9: 38,219,021 I66T probably benign Het
Olr1 G T 6: 129,493,609 D198E probably benign Het
Pafah1b1 A T 11: 74,684,452 S209T probably damaging Het
Phf14 A T 6: 11,961,642 Y426F possibly damaging Het
Phldb1 A G 9: 44,704,158 V855A probably benign Het
Pira2 T G 7: 3,844,593 R32S possibly damaging Het
Pnldc1 T C 17: 12,892,789 I344V probably benign Het
Prss29 T C 17: 25,320,907 V93A probably benign Het
Ptpn13 C T 5: 103,492,232 L186F probably damaging Het
Ralgps1 A C 2: 33,158,987 C303W probably damaging Het
Sdr42e1 T A 8: 117,663,603 N100Y probably damaging Het
Serpina11 A T 12: 103,986,244 L96Q probably damaging Het
Slc12a8 G A 16: 33,624,918 R448H probably benign Het
Snrpd1 T A 18: 10,626,892 V53E probably benign Het
Ssbp1 T C 6: 40,477,949 V114A possibly damaging Het
T A G 17: 8,436,205 E47G probably damaging Het
Tmem156 T C 5: 65,073,768 K189R probably benign Het
Trim47 G T 11: 116,107,852 Q314K possibly damaging Het
Vmn2r3 G T 3: 64,278,826 P146Q probably damaging Het
Vmn2r6 A C 3: 64,556,594 V273G probably damaging Het
Wrnip1 G T 13: 32,806,856 R366L probably damaging Het
Zfp981 A T 4: 146,536,900 H94L possibly damaging Het
Other mutations in Morc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Morc2a APN 11 3680283 missense probably damaging 0.99
IGL00914:Morc2a APN 11 3668844 splice site probably null
IGL01081:Morc2a APN 11 3688149 missense probably damaging 1.00
IGL01092:Morc2a APN 11 3684042 missense probably benign 0.00
IGL01292:Morc2a APN 11 3688175 missense probably damaging 1.00
IGL01326:Morc2a APN 11 3681775 missense probably benign 0.03
IGL01526:Morc2a APN 11 3650428 missense probably benign 0.00
IGL01651:Morc2a APN 11 3658727 critical splice donor site probably null
IGL02860:Morc2a APN 11 3661821 splice site probably benign
IGL03372:Morc2a APN 11 3681813 splice site probably benign
R0136:Morc2a UTSW 11 3685907 intron probably null
R0267:Morc2a UTSW 11 3678567 missense probably benign 0.03
R0279:Morc2a UTSW 11 3683989 missense probably benign 0.09
R0556:Morc2a UTSW 11 3681809 critical splice donor site probably null
R1084:Morc2a UTSW 11 3650454 splice site probably benign
R1148:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1148:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1341:Morc2a UTSW 11 3680216 missense possibly damaging 0.80
R1460:Morc2a UTSW 11 3683794 missense probably benign 0.01
R1493:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1665:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1668:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1669:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1812:Morc2a UTSW 11 3685831 missense probably damaging 0.98
R2132:Morc2a UTSW 11 3679787 missense possibly damaging 0.89
R2133:Morc2a UTSW 11 3680302 nonsense probably null
R2200:Morc2a UTSW 11 3683919 missense probably benign 0.00
R2698:Morc2a UTSW 11 3685400 missense probably damaging 1.00
R3236:Morc2a UTSW 11 3683612 missense probably benign
R3698:Morc2a UTSW 11 3679672 nonsense probably null
R3743:Morc2a UTSW 11 3683700 missense possibly damaging 0.46
R4119:Morc2a UTSW 11 3683868 missense probably benign 0.00
R4898:Morc2a UTSW 11 3676664 nonsense probably null
R5228:Morc2a UTSW 11 3685439 missense probably damaging 0.96
R5395:Morc2a UTSW 11 3688232 missense possibly damaging 0.94
R5808:Morc2a UTSW 11 3683781 missense probably benign 0.00
R5942:Morc2a UTSW 11 3679936 missense probably damaging 1.00
R6634:Morc2a UTSW 11 3672376 critical splice donor site probably null
R7056:Morc2a UTSW 11 3675925 missense probably damaging 1.00
R7537:Morc2a UTSW 11 3683566 nonsense probably null
R8014:Morc2a UTSW 11 3677419 missense probably damaging 1.00
RF013:Morc2a UTSW 11 3676191 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTTGGGCATGCAGATTTAACTG -3'
(R):5'- ACAGCAGGCATTAACATCTTCTC -3'

Sequencing Primer
(F):5'- GGCATGCAGATTTAACTGAAATTTGG -3'
(R):5'- CAAGATCAAGTCCACCAAGT -3'
Posted On2016-06-21