Incidental Mutation 'R5148:Ly6f'
ID395216
Institutional Source Beutler Lab
Gene Symbol Ly6f
Ensembl Gene ENSMUSG00000022583
Gene Namelymphocyte antigen 6 complex, locus F
Synonyms
MMRRC Submission 043262-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5148 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location75268421-75272235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75271797 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 118 (T118A)
Ref Sequence ENSEMBL: ENSMUSP00000140899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023247] [ENSMUST00000189654]
Predicted Effect probably benign
Transcript: ENSMUST00000023247
AA Change: T118A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023247
Gene: ENSMUSG00000022583
AA Change: T118A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 1.94e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189654
AA Change: T118A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140899
Gene: ENSMUSG00000022583
AA Change: T118A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 1.94e-35 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 A T 3: 127,025,636 probably null Het
Atf7 A G 15: 102,547,173 M252T probably benign Het
Cacna1h C A 17: 25,387,545 D1027Y probably damaging Het
Cngb1 A G 8: 95,265,983 V667A probably benign Het
Cntf T C 19: 12,764,004 E164G probably damaging Het
Dbt T C 3: 116,528,244 probably benign Het
Egfem1 G A 3: 29,457,823 probably benign Het
Gm12790 C T 4: 101,968,071 V49I possibly damaging Het
Gm5444 C T 13: 4,834,315 noncoding transcript Het
Gpcpd1 A T 2: 132,534,190 Y574* probably null Het
Gss G T 2: 155,573,109 N225K possibly damaging Het
Il17rc G T 6: 113,482,997 A635S probably benign Het
Lhfpl5 T A 17: 28,579,968 D150E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc40 T G 3: 158,054,569 probably null Het
Malrd1 A G 2: 16,142,226 N1960D unknown Het
Map3k14 T C 11: 103,239,332 H253R probably benign Het
Morc2a T C 11: 3,689,084 L1025P probably damaging Het
Nlrc5 G T 8: 94,476,693 G474W probably damaging Het
Olfr1162 G A 2: 88,050,393 T77I probably benign Het
Olfr1487 C A 19: 13,619,510 S116* probably null Het
Olfr894 T C 9: 38,219,021 I66T probably benign Het
Olr1 G T 6: 129,493,609 D198E probably benign Het
Pafah1b1 A T 11: 74,684,452 S209T probably damaging Het
Phf14 A T 6: 11,961,642 Y426F possibly damaging Het
Phldb1 A G 9: 44,704,158 V855A probably benign Het
Pira2 T G 7: 3,844,593 R32S possibly damaging Het
Pnldc1 T C 17: 12,892,789 I344V probably benign Het
Prss29 T C 17: 25,320,907 V93A probably benign Het
Ptpn13 C T 5: 103,492,232 L186F probably damaging Het
Ralgps1 A C 2: 33,158,987 C303W probably damaging Het
Sdr42e1 T A 8: 117,663,603 N100Y probably damaging Het
Serpina11 A T 12: 103,986,244 L96Q probably damaging Het
Slc12a8 G A 16: 33,624,918 R448H probably benign Het
Snrpd1 T A 18: 10,626,892 V53E probably benign Het
Ssbp1 T C 6: 40,477,949 V114A possibly damaging Het
T A G 17: 8,436,205 E47G probably damaging Het
Tmem156 T C 5: 65,073,768 K189R probably benign Het
Trim47 G T 11: 116,107,852 Q314K possibly damaging Het
Vmn2r3 G T 3: 64,278,826 P146Q probably damaging Het
Vmn2r6 A C 3: 64,556,594 V273G probably damaging Het
Wrnip1 G T 13: 32,806,856 R366L probably damaging Het
Zfp981 A T 4: 146,536,900 H94L possibly damaging Het
Other mutations in Ly6f
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0480:Ly6f UTSW 15 75271677 missense probably damaging 1.00
R1084:Ly6f UTSW 15 75268773 missense probably damaging 1.00
R3036:Ly6f UTSW 15 75268787 missense probably damaging 1.00
R3113:Ly6f UTSW 15 75271728 missense probably benign 0.28
R4549:Ly6f UTSW 15 75271730 missense probably benign
R4824:Ly6f UTSW 15 75271720 missense probably damaging 0.99
R5211:Ly6f UTSW 15 75271803 missense probably damaging 1.00
R5295:Ly6f UTSW 15 75271639 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CCATGATGTTTTGCAGACTCTC -3'
(R):5'- GTGGGGCATTTACCAAGCAG -3'

Sequencing Primer
(F):5'- GTTTTGCAGACTCTCAAAGAAGG -3'
(R):5'- CAGGGGCTATAAAGTTGAAACAAC -3'
Posted On2016-06-21