Incidental Mutation 'R5148:Atf7'
ID 395217
Institutional Source Beutler Lab
Gene Symbol Atf7
Ensembl Gene ENSMUSG00000099083
Gene Name activating transcription factor 7
Synonyms 9430065F09Rik, 1110012F10Rik, C130020M04Rik
MMRRC Submission 043262-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5148 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 102434381-102533899 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102455608 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 252 (M252T)
Ref Sequence ENSEMBL: ENSMUSP00000139243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108828] [ENSMUST00000169033] [ENSMUST00000183452] [ENSMUST00000183765] [ENSMUST00000184077] [ENSMUST00000184485] [ENSMUST00000184616] [ENSMUST00000184772] [ENSMUST00000184906] [ENSMUST00000185070]
AlphaFold Q8R0S1
Predicted Effect probably benign
Transcript: ENSMUST00000108828
AA Change: M252T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000104456
Gene: ENSMUSG00000099083
AA Change: M252T

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169033
AA Change: M252T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000130130
Gene: ENSMUSG00000099083
AA Change: M252T

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183452
SMART Domains Protein: ENSMUSP00000139367
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183727
Predicted Effect probably benign
Transcript: ENSMUST00000183765
SMART Domains Protein: ENSMUSP00000139054
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184077
SMART Domains Protein: ENSMUSP00000139217
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184485
AA Change: M252T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000139308
Gene: ENSMUSG00000099083
AA Change: M252T

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184616
AA Change: M252T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000139181
Gene: ENSMUSG00000099083
AA Change: M252T

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184772
AA Change: M252T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000138975
Gene: ENSMUSG00000052414
AA Change: M252T

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184906
AA Change: M252T

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000139243
Gene: ENSMUSG00000099083
AA Change: M252T

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185070
SMART Domains Protein: ENSMUSP00000139379
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele exhibit increased marble burying, increased startle response, and decreased prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 A T 3: 126,819,285 (GRCm39) probably null Het
Cacna1h C A 17: 25,606,519 (GRCm39) D1027Y probably damaging Het
Cngb1 A G 8: 95,992,611 (GRCm39) V667A probably benign Het
Cntf T C 19: 12,741,368 (GRCm39) E164G probably damaging Het
Dbt T C 3: 116,321,893 (GRCm39) probably benign Het
Egfem1 G A 3: 29,511,972 (GRCm39) probably benign Het
Gm12790 C T 4: 101,825,268 (GRCm39) V49I possibly damaging Het
Gm5444 C T 13: 4,884,314 (GRCm39) noncoding transcript Het
Gpcpd1 A T 2: 132,376,110 (GRCm39) Y574* probably null Het
Gss G T 2: 155,415,029 (GRCm39) N225K possibly damaging Het
Il17rc G T 6: 113,459,958 (GRCm39) A635S probably benign Het
Lhfpl5 T A 17: 28,798,942 (GRCm39) D150E probably damaging Het
Lin9 T A 1: 180,496,763 (GRCm39) L351I probably benign Het
Lrrc40 T G 3: 157,760,206 (GRCm39) probably null Het
Ly6f A G 15: 75,143,646 (GRCm39) T118A probably benign Het
Malrd1 A G 2: 16,147,037 (GRCm39) N1960D unknown Het
Map3k14 T C 11: 103,130,158 (GRCm39) H253R probably benign Het
Morc2a T C 11: 3,639,084 (GRCm39) L1025P probably damaging Het
Nlrc5 G T 8: 95,203,321 (GRCm39) G474W probably damaging Het
Olr1 G T 6: 129,470,572 (GRCm39) D198E probably benign Het
Or5b123 C A 19: 13,596,874 (GRCm39) S116* probably null Het
Or5d14 G A 2: 87,880,737 (GRCm39) T77I probably benign Het
Or8c16 T C 9: 38,130,317 (GRCm39) I66T probably benign Het
Pafah1b1 A T 11: 74,575,278 (GRCm39) S209T probably damaging Het
Phf14 A T 6: 11,961,641 (GRCm39) Y426F possibly damaging Het
Phldb1 A G 9: 44,615,455 (GRCm39) V855A probably benign Het
Pira2 T G 7: 3,847,592 (GRCm39) R32S possibly damaging Het
Pnldc1 T C 17: 13,111,676 (GRCm39) I344V probably benign Het
Prss29 T C 17: 25,539,881 (GRCm39) V93A probably benign Het
Ptpn13 C T 5: 103,640,098 (GRCm39) L186F probably damaging Het
Ralgps1 A C 2: 33,048,999 (GRCm39) C303W probably damaging Het
Sdr42e1 T A 8: 118,390,342 (GRCm39) N100Y probably damaging Het
Serpina11 A T 12: 103,952,503 (GRCm39) L96Q probably damaging Het
Slc12a8 G A 16: 33,445,288 (GRCm39) R448H probably benign Het
Snrpd1 T A 18: 10,626,892 (GRCm39) V53E probably benign Het
Ssbp1 T C 6: 40,454,883 (GRCm39) V114A possibly damaging Het
T A G 17: 8,655,037 (GRCm39) E47G probably damaging Het
Tmem156 T C 5: 65,231,111 (GRCm39) K189R probably benign Het
Trim47 G T 11: 115,998,678 (GRCm39) Q314K possibly damaging Het
Vmn2r3 G T 3: 64,186,247 (GRCm39) P146Q probably damaging Het
Vmn2r6 A C 3: 64,464,015 (GRCm39) V273G probably damaging Het
Wrnip1 G T 13: 32,990,839 (GRCm39) R366L probably damaging Het
Zfp981 A T 4: 146,621,357 (GRCm39) H94L possibly damaging Het
Other mutations in Atf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01914:Atf7 APN 15 102,459,913 (GRCm39) nonsense probably null
R2183:Atf7 UTSW 15 102,454,908 (GRCm39) missense possibly damaging 0.93
R2516:Atf7 UTSW 15 102,437,439 (GRCm39) intron probably benign
R3114:Atf7 UTSW 15 102,442,858 (GRCm39) missense probably benign 0.10
R3115:Atf7 UTSW 15 102,442,858 (GRCm39) missense probably benign 0.10
R4544:Atf7 UTSW 15 102,442,762 (GRCm39) missense probably benign 0.08
R4545:Atf7 UTSW 15 102,442,762 (GRCm39) missense probably benign 0.08
R4546:Atf7 UTSW 15 102,442,762 (GRCm39) missense probably benign 0.08
R5568:Atf7 UTSW 15 102,471,757 (GRCm39) missense probably damaging 0.99
R5688:Atf7 UTSW 15 102,459,944 (GRCm39) missense probably damaging 1.00
R5805:Atf7 UTSW 15 102,466,022 (GRCm39) splice site probably null
R6021:Atf7 UTSW 15 102,465,908 (GRCm39) missense probably benign 0.20
R6259:Atf7 UTSW 15 102,455,673 (GRCm39) missense probably damaging 1.00
R6347:Atf7 UTSW 15 102,454,914 (GRCm39) missense possibly damaging 0.91
R6476:Atf7 UTSW 15 102,502,147 (GRCm39) missense probably benign 0.13
R6794:Atf7 UTSW 15 102,465,900 (GRCm39) missense probably benign 0.09
R7104:Atf7 UTSW 15 102,442,670 (GRCm39) missense probably benign 0.40
R7369:Atf7 UTSW 15 102,462,244 (GRCm39) missense probably damaging 0.98
R8111:Atf7 UTSW 15 102,471,769 (GRCm39) missense probably damaging 0.96
R8244:Atf7 UTSW 15 102,437,301 (GRCm39) missense unknown
R8768:Atf7 UTSW 15 102,449,324 (GRCm39) missense probably benign 0.06
R8785:Atf7 UTSW 15 102,454,974 (GRCm39) missense probably benign
R8811:Atf7 UTSW 15 102,502,144 (GRCm39) missense probably damaging 0.99
R9211:Atf7 UTSW 15 102,437,117 (GRCm39) missense unknown
R9408:Atf7 UTSW 15 102,462,286 (GRCm39) missense probably damaging 1.00
R9446:Atf7 UTSW 15 102,459,923 (GRCm39) missense probably damaging 0.96
R9564:Atf7 UTSW 15 102,442,712 (GRCm39) missense probably benign
X0027:Atf7 UTSW 15 102,502,105 (GRCm39) critical splice donor site probably null
Z1088:Atf7 UTSW 15 102,455,617 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCAGGGTCTTTTCCAACCC -3'
(R):5'- AGATGATTTCCCAGGCTATCCC -3'

Sequencing Primer
(F):5'- CCACAGCAGAATATCTTTAGCTATGC -3'
(R):5'- TCTTGTGAGCAGGTTACACAGAAC -3'
Posted On 2016-06-21