Mutagenetix > Incidental Mutation

Incidental Mutation 'R5149:Atp1a4'

395229

Institutional Source

Beutler Lab

Gene Symbol

Atp1a4

Ensembl Gene

ENSMUSG00000007107

Gene Name

ATPase, Na+/K+ transporting, alpha 4 polypeptide

Synonyms

MMRRC Submission

042732-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5149 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

172223513-172258414 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 172232005 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 840 (I840T)

Ref Sequence

ENSEMBL: ENSMUSP00000106874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111243]

AlphaFold

Q9WV27

Predicted Effect

probably damaging
Transcript: ENSMUST00000111243
AA Change: I840T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: I840T

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
Cation_ATPase_N	51	125	1.22e-14	SMART
Pfam:E1-E2_ATPase	144	375	2.6e-59	PFAM
Pfam:Hydrolase	380	738	8.1e-19	PFAM
Pfam:HAD	383	735	1.6e-17	PFAM
Pfam:Cation_ATPase	437	531	9.2e-25	PFAM
Pfam:Cation_ATPase_C	808	1017	1.2e-47	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahsg	A	G	16: 22,898,923	T245A	probably benign	Het
Akr1c13	G	T	13: 4,194,169	V74L	probably benign	Het
Amt	G	A	9: 108,301,451	V389I	possibly damaging	Het
Ankrd26	T	C	6: 118,558,996	N159S	probably benign	Het
Capn1	T	C	19: 5,990,334		probably null	Het
Col27a1	T	C	4: 63,331,427		probably benign	Het
Cyp2j5	A	G	4: 96,659,507	L166P	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dchs1	G	A	7: 105,755,658	T2559I	probably damaging	Het
Dnah12	C	A	14: 26,850,926	S258*	probably null	Het
Dpep1	A	T	8: 123,200,438	T309S	probably benign	Het
Epha5	A	T	5: 84,150,358	F559L	probably damaging	Het
Gm3409	T	C	5: 146,537,761	I29T	possibly damaging	Het
Grhl1	CAGAAGAAG	CAGAAG	12: 24,612,179		probably benign	Het
Gtf3c1	G	T	7: 125,668,037	R941S	probably damaging	Het
Helb	C	T	10: 120,105,743	E347K	probably benign	Het
Ighv14-3	A	G	12: 114,060,090	S36P	probably damaging	Het
Klrb1c	T	A	6: 128,783,707	M211L	probably benign	Het
Larp7	C	T	3: 127,540,811	E510K	probably damaging	Het
Lrig1	C	T	6: 94,628,044	R190Q	possibly damaging	Het
March6	A	G	15: 31,461,994	S863P	possibly damaging	Het
Mgst2	A	G	3: 51,682,537	N132S	probably benign	Het
Nlgn2	C	T	11: 69,825,390	R775H	probably damaging	Het
Olfr1138	A	T	2: 87,737,405	S306R	probably benign	Het
Olfr135	A	C	17: 38,208,317	E24A	possibly damaging	Het
Olfr804	T	C	10: 129,705,508	V210A	probably benign	Het
Papln	A	T	12: 83,771,882		probably null	Het
Poteg	C	T	8: 27,481,643	S395L	possibly damaging	Het
Prox1	T	A	1: 190,147,053	I643F	possibly damaging	Het
Sept4	A	G	11: 87,589,245	E211G	probably damaging	Het
Serpinb6e	A	G	13: 33,832,485	F422L	probably damaging	Het
Slc22a19	A	G	19: 7,711,138	L19P	probably damaging	Het
Snf8	G	T	11: 96,043,460	A136S	probably benign	Het
Sparcl1	C	T	5: 104,085,763	M573I	probably damaging	Het
Spta1	A	G	1: 174,247,434	T2409A	probably damaging	Het
Tat	A	G	8: 109,996,818	S313G	probably benign	Het
Tep1	A	T	14: 50,837,398	C1785*	probably null	Het
Tmem132b	A	G	5: 125,622,925	S176G	probably damaging	Het
Tnfrsf8	T	C	4: 145,303,105	R42G	possibly damaging	Het
Trio	T	C	15: 27,754,029	D2124G	possibly damaging	Het
Trp53bp1	A	T	2: 121,216,117	D1067E	probably benign	Het
Tspan13	T	C	12: 36,024,066	S24G	probably damaging	Het
Zdbf2	T	C	1: 63,304,903	S814P	possibly damaging	Het
Zfp213	C	A	17: 23,561,399	R49L	probably damaging	Het

Other mutations in Atp1a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Atp1a4	APN	1	172239806	missense	probably damaging	1.00
IGL00924:Atp1a4	APN	1	172246772	missense	probably damaging	1.00
IGL01288:Atp1a4	APN	1	172257907	missense	possibly damaging	0.77
IGL01665:Atp1a4	APN	1	172246724	missense	probably benign
IGL02156:Atp1a4	APN	1	172257962	missense	probably benign
IGL02170:Atp1a4	APN	1	172234536	missense	possibly damaging	0.94
IGL02228:Atp1a4	APN	1	172254885	missense	possibly damaging	0.69
IGL02505:Atp1a4	APN	1	172235075	missense	probably damaging	1.00
IGL02653:Atp1a4	APN	1	172251406	missense	possibly damaging	0.81
IGL02792:Atp1a4	APN	1	172227299	critical splice donor site	probably null
IGL02794:Atp1a4	APN	1	172244086	missense	probably benign	0.13
IGL03102:Atp1a4	APN	1	172231151	missense	probably damaging	1.00
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0276:Atp1a4	UTSW	1	172257901	missense	probably damaging	1.00
R0309:Atp1a4	UTSW	1	172234987	missense	probably damaging	1.00
R0525:Atp1a4	UTSW	1	172239688	splice site	probably benign
R0615:Atp1a4	UTSW	1	172232060	splice site	probably benign
R0730:Atp1a4	UTSW	1	172240207	splice site	probably benign
R1412:Atp1a4	UTSW	1	172232009	missense	probably damaging	0.97
R1652:Atp1a4	UTSW	1	172254903	missense	probably damaging	1.00
R1898:Atp1a4	UTSW	1	172235048	missense	probably damaging	0.99
R1968:Atp1a4	UTSW	1	172240164	missense	probably benign
R2291:Atp1a4	UTSW	1	172244906	missense	probably damaging	1.00
R2897:Atp1a4	UTSW	1	172246690	missense	probably damaging	1.00
R2908:Atp1a4	UTSW	1	172234477	missense	probably benign
R3119:Atp1a4	UTSW	1	172239826	missense	probably damaging	0.99
R3731:Atp1a4	UTSW	1	172233961	missense	probably damaging	1.00
R4447:Atp1a4	UTSW	1	172234431	missense	probably damaging	0.99
R4602:Atp1a4	UTSW	1	172239765	missense	probably damaging	1.00
R4670:Atp1a4	UTSW	1	172235000	missense	probably benign	0.07
R4674:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4675:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4785:Atp1a4	UTSW	1	172254110	nonsense	probably null
R4958:Atp1a4	UTSW	1	172231151	missense	probably damaging	1.00
R5015:Atp1a4	UTSW	1	172254082	missense	probably damaging	1.00
R5234:Atp1a4	UTSW	1	172227170	missense	possibly damaging	0.73
R5501:Atp1a4	UTSW	1	172246832	missense	probably damaging	1.00
R5682:Atp1a4	UTSW	1	172254163	missense	probably damaging	0.99
R5872:Atp1a4	UTSW	1	172244408	missense	probably damaging	1.00
R5933:Atp1a4	UTSW	1	172232274	missense	possibly damaging	0.91
R6722:Atp1a4	UTSW	1	172258050	unclassified	probably benign
R7087:Atp1a4	UTSW	1	172246702	missense	probably damaging	1.00
R7122:Atp1a4	UTSW	1	172231936	missense	possibly damaging	0.47
R7381:Atp1a4	UTSW	1	172240115	missense	possibly damaging	0.70
R7431:Atp1a4	UTSW	1	172250907	missense	probably benign	0.31
R8269:Atp1a4	UTSW	1	172232325	missense	probably damaging	1.00
R8400:Atp1a4	UTSW	1	172234494	missense	probably damaging	1.00
R8559:Atp1a4	UTSW	1	172251330	missense	probably damaging	1.00
R8680:Atp1a4	UTSW	1	172250999	missense	probably damaging	1.00
R8777:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8777-TAIL:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8867:Atp1a4	UTSW	1	172244924	missense	probably damaging	0.99
R8869:Atp1a4	UTSW	1	172227123	missense	probably benign
R9260:Atp1a4	UTSW	1	172246792	missense	probably damaging	1.00
R9300:Atp1a4	UTSW	1	172239831	missense	probably damaging	1.00
R9545:Atp1a4	UTSW	1	172250897	missense	probably benign	0.35
Z1176:Atp1a4	UTSW	1	172231954	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- ATCAACGGTTCTCTGTGGTCC -3'
(R):5'- AGCGCCAGGTTTCTCTTTG -3'

Sequencing Primer
(F):5'- GTCCCAGAGCCAAGTCGTTTC -3'
(R):5'- GGGGATTCCTACGATCTGATCC -3'

Posted On

2016-06-21