Incidental Mutation 'R5149:Spta1'
ID 395230
Institutional Source Beutler Lab
Gene Symbol Spta1
Ensembl Gene ENSMUSG00000026532
Gene Name spectrin alpha, erythrocytic 1
Synonyms erythroid, Spna-1, ihj, Spna1
MMRRC Submission 042732-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.854) question?
Stock # R5149 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 174000342-174076016 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 174075000 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2409 (T2409A)
Ref Sequence ENSEMBL: ENSMUSP00000027817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817] [ENSMUST00000061990] [ENSMUST00000214725]
AlphaFold P08032
Predicted Effect probably damaging
Transcript: ENSMUST00000027817
AA Change: T2409A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: T2409A

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061990
SMART Domains Protein: ENSMUSP00000050893
Gene: ENSMUSG00000050788

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-53 PFAM
Pfam:7tm_1 41 290 3.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156092
Predicted Effect probably benign
Transcript: ENSMUST00000214725
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsg A G 16: 22,717,673 (GRCm39) T245A probably benign Het
Akr1c13 G T 13: 4,244,168 (GRCm39) V74L probably benign Het
Amt G A 9: 108,178,650 (GRCm39) V389I possibly damaging Het
Ankrd26 T C 6: 118,535,957 (GRCm39) N159S probably benign Het
Atp1a4 A G 1: 172,059,572 (GRCm39) I840T probably damaging Het
Capn1 T C 19: 6,040,364 (GRCm39) probably null Het
Col27a1 T C 4: 63,249,664 (GRCm39) probably benign Het
Cyp2j5 A G 4: 96,547,744 (GRCm39) L166P probably damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dchs1 G A 7: 105,404,865 (GRCm39) T2559I probably damaging Het
Dnah12 C A 14: 26,572,883 (GRCm39) S258* probably null Het
Dpep1 A T 8: 123,927,177 (GRCm39) T309S probably benign Het
Epha5 A T 5: 84,298,217 (GRCm39) F559L probably damaging Het
Gm3409 T C 5: 146,474,571 (GRCm39) I29T possibly damaging Het
Grhl1 CAGAAGAAG CAGAAG 12: 24,662,178 (GRCm39) probably benign Het
Gtf3c1 G T 7: 125,267,209 (GRCm39) R941S probably damaging Het
Helb C T 10: 119,941,648 (GRCm39) E347K probably benign Het
Ighv14-3 A G 12: 114,023,710 (GRCm39) S36P probably damaging Het
Klrb1c T A 6: 128,760,670 (GRCm39) M211L probably benign Het
Larp7 C T 3: 127,334,460 (GRCm39) E510K probably damaging Het
Lrig1 C T 6: 94,605,025 (GRCm39) R190Q possibly damaging Het
Marchf6 A G 15: 31,462,140 (GRCm39) S863P possibly damaging Het
Mgst2 A G 3: 51,589,958 (GRCm39) N132S probably benign Het
Nlgn2 C T 11: 69,716,216 (GRCm39) R775H probably damaging Het
Or2n1c A C 17: 38,519,208 (GRCm39) E24A possibly damaging Het
Or5w15 A T 2: 87,567,749 (GRCm39) S306R probably benign Het
Or6c6c T C 10: 129,541,377 (GRCm39) V210A probably benign Het
Papln A T 12: 83,818,656 (GRCm39) probably null Het
Poteg C T 8: 27,971,671 (GRCm39) S395L possibly damaging Het
Prox1 T A 1: 189,879,250 (GRCm39) I643F possibly damaging Het
Septin4 A G 11: 87,480,071 (GRCm39) E211G probably damaging Het
Serpinb6e A G 13: 34,016,468 (GRCm39) F422L probably damaging Het
Slc22a19 A G 19: 7,688,503 (GRCm39) L19P probably damaging Het
Snf8 G T 11: 95,934,286 (GRCm39) A136S probably benign Het
Sparcl1 C T 5: 104,233,629 (GRCm39) M573I probably damaging Het
Tat A G 8: 110,723,450 (GRCm39) S313G probably benign Het
Tep1 A T 14: 51,074,855 (GRCm39) C1785* probably null Het
Tmem132b A G 5: 125,699,989 (GRCm39) S176G probably damaging Het
Tnfrsf8 T C 4: 145,029,675 (GRCm39) R42G possibly damaging Het
Trio T C 15: 27,754,115 (GRCm39) D2124G possibly damaging Het
Trp53bp1 A T 2: 121,046,598 (GRCm39) D1067E probably benign Het
Tspan13 T C 12: 36,074,065 (GRCm39) S24G probably damaging Het
Zdbf2 T C 1: 63,344,062 (GRCm39) S814P possibly damaging Het
Zfp213 C A 17: 23,780,373 (GRCm39) R49L probably damaging Het
Other mutations in Spta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Spta1 APN 1 174,035,956 (GRCm39) nonsense probably null
IGL01095:Spta1 APN 1 174,041,051 (GRCm39) missense probably benign 0.02
IGL01144:Spta1 APN 1 174,014,829 (GRCm39) missense probably benign 0.05
IGL01455:Spta1 APN 1 174,030,877 (GRCm39) missense possibly damaging 0.78
IGL01541:Spta1 APN 1 174,044,725 (GRCm39) missense probably benign 0.03
IGL01613:Spta1 APN 1 174,035,960 (GRCm39) missense probably damaging 1.00
IGL01804:Spta1 APN 1 174,071,746 (GRCm39) missense probably benign 0.42
IGL01859:Spta1 APN 1 174,001,938 (GRCm39) missense probably damaging 1.00
IGL01898:Spta1 APN 1 174,041,428 (GRCm39) missense probably benign 0.00
IGL02106:Spta1 APN 1 174,030,860 (GRCm39) missense probably benign 0.02
IGL02166:Spta1 APN 1 174,017,797 (GRCm39) missense probably damaging 1.00
IGL02224:Spta1 APN 1 174,045,255 (GRCm39) critical splice donor site probably benign
IGL02318:Spta1 APN 1 174,002,029 (GRCm39) missense possibly damaging 0.51
IGL02392:Spta1 APN 1 174,046,380 (GRCm39) missense probably damaging 0.96
IGL02852:Spta1 APN 1 174,071,676 (GRCm39) missense probably benign 0.24
IGL02861:Spta1 APN 1 174,039,164 (GRCm39) missense probably damaging 1.00
IGL02982:Spta1 APN 1 174,014,854 (GRCm39) missense probably benign 0.00
IGL03057:Spta1 APN 1 174,008,624 (GRCm39) missense probably benign 0.19
IGL03215:Spta1 APN 1 174,046,309 (GRCm39) missense probably damaging 1.00
IGL03263:Spta1 APN 1 174,041,484 (GRCm39) missense probably damaging 0.99
IGL03272:Spta1 APN 1 174,041,710 (GRCm39) missense probably benign 0.08
bounced UTSW 1 174,052,023 (GRCm39) missense probably damaging 1.00
Capillus UTSW 1 174,045,254 (GRCm39) critical splice donor site probably null
Deflection UTSW 1 174,068,653 (GRCm39) missense probably damaging 1.00
Goldfoil UTSW 1 174,046,078 (GRCm39) missense probably damaging 1.00
hanging UTSW 1 174,006,315 (GRCm39) missense probably damaging 0.99
Klimt UTSW 1 174,029,952 (GRCm39) missense probably damaging 1.00
Rutherford UTSW 1 174,034,676 (GRCm39) missense probably null 1.00
Thread UTSW 1 174,025,201 (GRCm39) nonsense probably null
H8786:Spta1 UTSW 1 174,007,405 (GRCm39) missense probably damaging 0.98
R0003:Spta1 UTSW 1 174,032,839 (GRCm39) missense probably damaging 0.98
R0003:Spta1 UTSW 1 174,032,839 (GRCm39) missense probably damaging 0.98
R0010:Spta1 UTSW 1 174,045,509 (GRCm39) missense probably benign 0.03
R0010:Spta1 UTSW 1 174,045,509 (GRCm39) missense probably benign 0.03
R0078:Spta1 UTSW 1 174,034,598 (GRCm39) splice site probably benign
R0172:Spta1 UTSW 1 174,058,352 (GRCm39) missense probably damaging 1.00
R0206:Spta1 UTSW 1 174,020,526 (GRCm39) missense probably damaging 1.00
R0208:Spta1 UTSW 1 174,020,526 (GRCm39) missense probably damaging 1.00
R0276:Spta1 UTSW 1 174,045,460 (GRCm39) missense probably damaging 1.00
R0288:Spta1 UTSW 1 174,070,745 (GRCm39) missense probably damaging 0.99
R0323:Spta1 UTSW 1 174,046,017 (GRCm39) missense probably damaging 1.00
R0454:Spta1 UTSW 1 174,041,508 (GRCm39) missense probably damaging 1.00
R0508:Spta1 UTSW 1 174,052,023 (GRCm39) missense probably damaging 1.00
R0698:Spta1 UTSW 1 174,008,670 (GRCm39) missense probably damaging 1.00
R0751:Spta1 UTSW 1 174,012,256 (GRCm39) missense probably damaging 1.00
R0925:Spta1 UTSW 1 174,001,992 (GRCm39) missense possibly damaging 0.85
R0941:Spta1 UTSW 1 174,072,771 (GRCm39) unclassified probably benign
R1131:Spta1 UTSW 1 174,013,213 (GRCm39) missense probably damaging 1.00
R1171:Spta1 UTSW 1 174,039,180 (GRCm39) nonsense probably null
R1184:Spta1 UTSW 1 174,012,256 (GRCm39) missense probably damaging 1.00
R1401:Spta1 UTSW 1 174,050,250 (GRCm39) missense probably damaging 1.00
R1489:Spta1 UTSW 1 174,058,891 (GRCm39) missense probably damaging 0.97
R1532:Spta1 UTSW 1 174,074,919 (GRCm39) missense probably damaging 0.99
R1551:Spta1 UTSW 1 174,067,732 (GRCm39) missense possibly damaging 0.94
R1555:Spta1 UTSW 1 174,006,315 (GRCm39) missense probably damaging 0.99
R1566:Spta1 UTSW 1 174,012,272 (GRCm39) missense probably benign 0.00
R1586:Spta1 UTSW 1 174,041,061 (GRCm39) missense probably benign 0.00
R1676:Spta1 UTSW 1 174,007,405 (GRCm39) missense probably damaging 0.98
R1711:Spta1 UTSW 1 174,068,608 (GRCm39) missense probably damaging 1.00
R1795:Spta1 UTSW 1 174,073,296 (GRCm39) missense probably damaging 1.00
R1823:Spta1 UTSW 1 174,074,115 (GRCm39) missense probably benign 0.05
R1842:Spta1 UTSW 1 174,023,513 (GRCm39) missense probably benign 0.00
R1867:Spta1 UTSW 1 174,047,405 (GRCm39) missense probably benign 0.33
R1970:Spta1 UTSW 1 174,067,933 (GRCm39) missense possibly damaging 0.88
R2042:Spta1 UTSW 1 174,039,213 (GRCm39) missense probably benign 0.20
R2095:Spta1 UTSW 1 174,071,764 (GRCm39) missense possibly damaging 0.75
R2125:Spta1 UTSW 1 174,035,910 (GRCm39) missense possibly damaging 0.80
R2145:Spta1 UTSW 1 174,040,180 (GRCm39) missense probably benign 0.00
R2158:Spta1 UTSW 1 174,056,824 (GRCm39) missense probably benign 0.41
R2187:Spta1 UTSW 1 174,020,532 (GRCm39) missense probably damaging 1.00
R2250:Spta1 UTSW 1 174,071,680 (GRCm39) missense probably damaging 1.00
R2258:Spta1 UTSW 1 174,001,907 (GRCm39) missense possibly damaging 0.76
R2319:Spta1 UTSW 1 174,006,222 (GRCm39) critical splice acceptor site probably null
R3782:Spta1 UTSW 1 174,035,880 (GRCm39) missense probably damaging 1.00
R4058:Spta1 UTSW 1 174,068,703 (GRCm39) missense probably damaging 1.00
R4080:Spta1 UTSW 1 174,041,632 (GRCm39) missense probably benign 0.00
R4081:Spta1 UTSW 1 174,041,632 (GRCm39) missense probably benign 0.00
R4082:Spta1 UTSW 1 174,041,632 (GRCm39) missense probably benign 0.00
R4108:Spta1 UTSW 1 174,002,122 (GRCm39) missense probably benign 0.01
R4115:Spta1 UTSW 1 174,067,923 (GRCm39) missense probably damaging 1.00
R4303:Spta1 UTSW 1 174,007,418 (GRCm39) missense probably damaging 1.00
R4419:Spta1 UTSW 1 174,074,990 (GRCm39) nonsense probably null
R4525:Spta1 UTSW 1 174,034,676 (GRCm39) missense probably null 1.00
R4614:Spta1 UTSW 1 174,020,543 (GRCm39) missense probably damaging 1.00
R4673:Spta1 UTSW 1 174,018,628 (GRCm39) splice site probably null
R4782:Spta1 UTSW 1 174,058,232 (GRCm39) missense probably benign 0.01
R4825:Spta1 UTSW 1 174,071,608 (GRCm39) critical splice acceptor site probably null
R4829:Spta1 UTSW 1 174,065,493 (GRCm39) missense probably benign 0.01
R4873:Spta1 UTSW 1 174,003,396 (GRCm39) missense probably damaging 1.00
R4875:Spta1 UTSW 1 174,003,396 (GRCm39) missense probably damaging 1.00
R4898:Spta1 UTSW 1 174,065,400 (GRCm39) missense possibly damaging 0.94
R4910:Spta1 UTSW 1 174,045,429 (GRCm39) splice site probably null
R4911:Spta1 UTSW 1 174,013,213 (GRCm39) missense probably damaging 1.00
R4928:Spta1 UTSW 1 174,018,622 (GRCm39) missense probably benign 0.15
R4959:Spta1 UTSW 1 174,074,174 (GRCm39) missense probably damaging 0.97
R5009:Spta1 UTSW 1 174,067,789 (GRCm39) missense possibly damaging 0.62
R5293:Spta1 UTSW 1 174,023,551 (GRCm39) missense probably damaging 0.99
R5421:Spta1 UTSW 1 174,043,095 (GRCm39) missense probably damaging 0.99
R5457:Spta1 UTSW 1 174,044,759 (GRCm39) missense probably damaging 1.00
R5590:Spta1 UTSW 1 174,003,336 (GRCm39) missense possibly damaging 0.73
R5606:Spta1 UTSW 1 174,047,468 (GRCm39) missense probably damaging 1.00
R5736:Spta1 UTSW 1 174,041,821 (GRCm39) critical splice donor site probably null
R5834:Spta1 UTSW 1 174,012,363 (GRCm39) splice site probably null
R5845:Spta1 UTSW 1 174,068,662 (GRCm39) missense probably damaging 0.97
R5987:Spta1 UTSW 1 174,050,894 (GRCm39) missense probably damaging 1.00
R6102:Spta1 UTSW 1 174,052,086 (GRCm39) missense probably benign 0.01
R6221:Spta1 UTSW 1 174,009,342 (GRCm39) missense probably damaging 1.00
R6276:Spta1 UTSW 1 174,046,078 (GRCm39) missense probably damaging 1.00
R6317:Spta1 UTSW 1 174,068,653 (GRCm39) missense probably damaging 1.00
R6329:Spta1 UTSW 1 174,041,743 (GRCm39) missense possibly damaging 0.60
R6352:Spta1 UTSW 1 174,039,212 (GRCm39) missense possibly damaging 0.94
R6374:Spta1 UTSW 1 174,041,734 (GRCm39) missense probably damaging 1.00
R6376:Spta1 UTSW 1 174,030,888 (GRCm39) missense probably benign
R6387:Spta1 UTSW 1 174,058,899 (GRCm39) missense probably benign 0.01
R6451:Spta1 UTSW 1 174,044,767 (GRCm39) missense probably damaging 0.97
R6480:Spta1 UTSW 1 174,014,714 (GRCm39) splice site probably null
R6533:Spta1 UTSW 1 174,071,713 (GRCm39) missense probably damaging 1.00
R6585:Spta1 UTSW 1 174,006,251 (GRCm39) missense probably damaging 1.00
R6695:Spta1 UTSW 1 174,071,608 (GRCm39) critical splice acceptor site probably null
R6945:Spta1 UTSW 1 174,036,891 (GRCm39) missense possibly damaging 0.89
R7020:Spta1 UTSW 1 174,036,918 (GRCm39) missense probably damaging 1.00
R7086:Spta1 UTSW 1 174,027,050 (GRCm39) missense probably damaging 0.98
R7087:Spta1 UTSW 1 174,002,076 (GRCm39) missense probably benign
R7151:Spta1 UTSW 1 174,025,317 (GRCm39) missense probably damaging 1.00
R7193:Spta1 UTSW 1 174,012,178 (GRCm39) missense probably damaging 1.00
R7199:Spta1 UTSW 1 174,050,837 (GRCm39) missense possibly damaging 0.61
R7219:Spta1 UTSW 1 174,050,203 (GRCm39) missense probably damaging 0.96
R7343:Spta1 UTSW 1 174,050,915 (GRCm39) missense probably damaging 0.99
R7372:Spta1 UTSW 1 174,025,201 (GRCm39) nonsense probably null
R7472:Spta1 UTSW 1 174,074,065 (GRCm39) missense probably damaging 1.00
R7516:Spta1 UTSW 1 174,025,349 (GRCm39) missense probably damaging 1.00
R7627:Spta1 UTSW 1 174,032,944 (GRCm39) missense probably damaging 1.00
R7770:Spta1 UTSW 1 174,023,547 (GRCm39) nonsense probably null
R7784:Spta1 UTSW 1 174,030,017 (GRCm39) missense probably damaging 1.00
R7804:Spta1 UTSW 1 174,023,471 (GRCm39) missense possibly damaging 0.50
R7854:Spta1 UTSW 1 174,046,396 (GRCm39) critical splice donor site probably null
R7862:Spta1 UTSW 1 174,025,351 (GRCm39) critical splice donor site probably null
R7958:Spta1 UTSW 1 174,001,956 (GRCm39) missense probably benign 0.03
R8015:Spta1 UTSW 1 174,067,737 (GRCm39) missense probably damaging 1.00
R8059:Spta1 UTSW 1 174,045,936 (GRCm39) intron probably benign
R8076:Spta1 UTSW 1 174,014,797 (GRCm39) missense probably benign 0.00
R8152:Spta1 UTSW 1 174,045,510 (GRCm39) missense probably benign 0.03
R8235:Spta1 UTSW 1 174,029,952 (GRCm39) missense probably damaging 1.00
R8284:Spta1 UTSW 1 174,007,387 (GRCm39) missense probably benign 0.00
R8298:Spta1 UTSW 1 174,074,953 (GRCm39) missense probably damaging 1.00
R8312:Spta1 UTSW 1 174,067,777 (GRCm39) missense probably damaging 1.00
R8495:Spta1 UTSW 1 174,043,051 (GRCm39) missense probably benign 0.00
R8550:Spta1 UTSW 1 174,014,774 (GRCm39) missense probably damaging 1.00
R8675:Spta1 UTSW 1 174,058,249 (GRCm39) missense probably benign 0.01
R8757:Spta1 UTSW 1 174,040,940 (GRCm39) missense probably damaging 1.00
R8759:Spta1 UTSW 1 174,040,940 (GRCm39) missense probably damaging 1.00
R8848:Spta1 UTSW 1 174,025,310 (GRCm39) missense probably benign 0.05
R8883:Spta1 UTSW 1 174,021,145 (GRCm39) missense possibly damaging 0.82
R8884:Spta1 UTSW 1 174,045,254 (GRCm39) critical splice donor site probably null
R8896:Spta1 UTSW 1 174,045,548 (GRCm39) missense probably damaging 1.00
R8953:Spta1 UTSW 1 174,058,241 (GRCm39) missense probably benign 0.10
R9006:Spta1 UTSW 1 174,047,537 (GRCm39) missense probably damaging 1.00
R9013:Spta1 UTSW 1 174,050,174 (GRCm39) missense probably damaging 1.00
R9077:Spta1 UTSW 1 174,045,170 (GRCm39) missense probably damaging 1.00
R9129:Spta1 UTSW 1 174,058,911 (GRCm39) missense possibly damaging 0.77
R9207:Spta1 UTSW 1 174,039,139 (GRCm39) missense probably benign 0.01
R9229:Spta1 UTSW 1 174,067,750 (GRCm39) missense probably damaging 1.00
R9281:Spta1 UTSW 1 174,047,444 (GRCm39) missense probably damaging 1.00
R9290:Spta1 UTSW 1 174,045,204 (GRCm39) missense possibly damaging 0.94
R9307:Spta1 UTSW 1 174,035,978 (GRCm39) missense probably damaging 1.00
R9489:Spta1 UTSW 1 174,035,880 (GRCm39) missense probably damaging 1.00
R9605:Spta1 UTSW 1 174,035,880 (GRCm39) missense probably damaging 1.00
R9685:Spta1 UTSW 1 174,032,925 (GRCm39) missense probably damaging 1.00
RF002:Spta1 UTSW 1 174,058,926 (GRCm39) missense possibly damaging 0.62
RF018:Spta1 UTSW 1 174,036,885 (GRCm39) missense probably damaging 1.00
RF020:Spta1 UTSW 1 174,045,469 (GRCm39) missense probably damaging 1.00
RF020:Spta1 UTSW 1 174,041,010 (GRCm39) missense probably benign 0.42
T0722:Spta1 UTSW 1 174,018,632 (GRCm39) splice site probably benign
X0028:Spta1 UTSW 1 174,052,016 (GRCm39) missense probably damaging 1.00
Z1176:Spta1 UTSW 1 174,067,933 (GRCm39) missense probably damaging 0.99
Z1176:Spta1 UTSW 1 174,018,617 (GRCm39) missense probably damaging 1.00
Z1177:Spta1 UTSW 1 174,073,255 (GRCm39) missense probably benign 0.02
Z1177:Spta1 UTSW 1 174,017,728 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCTCTCCATCTGTGAGAACAAG -3'
(R):5'- TTGGCACCCTAGGTAGAGACTAG -3'

Sequencing Primer
(F):5'- CTCTCCATCTGTGAGAACAAGTGTTG -3'
(R):5'- ATAGATTTTTCTTAGCCCCCGC -3'
Posted On 2016-06-21