Incidental Mutation 'R5149:Mgst2'
ID395235
Institutional Source Beutler Lab
Gene Symbol Mgst2
Ensembl Gene ENSMUSG00000074604
Gene Namemicrosomal glutathione S-transferase 2
SynonymsMGST-II, GST2
MMRRC Submission 042732-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R5149 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location51660360-51682677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51682537 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 132 (N132S)
Ref Sequence ENSEMBL: ENSMUSP00000096705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099106] [ENSMUST00000118075] [ENSMUST00000121440] [ENSMUST00000159554] [ENSMUST00000161590]
Predicted Effect probably benign
Transcript: ENSMUST00000099106
AA Change: N132S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000096705
Gene: ENSMUSG00000074604
AA Change: N132S

DomainStartEndE-ValueType
Pfam:MAPEG 8 124 8.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118075
SMART Domains Protein: ENSMUSP00000113677
Gene: ENSMUSG00000061143

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
coiled coil region 90 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121440
SMART Domains Protein: ENSMUSP00000112637
Gene: ENSMUSG00000061143

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
low complexity region 12 32 N/A INTRINSIC
low complexity region 44 65 N/A INTRINSIC
MamL-1 67 126 6.54e-30 SMART
low complexity region 436 454 N/A INTRINSIC
coiled coil region 459 502 N/A INTRINSIC
low complexity region 504 515 N/A INTRINSIC
low complexity region 621 647 N/A INTRINSIC
low complexity region 698 714 N/A INTRINSIC
coiled coil region 736 778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159400
Predicted Effect probably benign
Transcript: ENSMUST00000159554
SMART Domains Protein: ENSMUSP00000141745
Gene: ENSMUSG00000074604

DomainStartEndE-ValueType
Pfam:MAPEG 8 80 3.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161230
Predicted Effect probably benign
Transcript: ENSMUST00000161590
SMART Domains Protein: ENSMUSP00000125670
Gene: ENSMUSG00000074604

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195423
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, several of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. This gene encodes a protein which catalyzes the conjugation of leukotriene A4 and reduced glutathione to produce leukotriene C4. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trap allele display resistance to induced ER stress related cell death and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsg A G 16: 22,898,923 T245A probably benign Het
Akr1c13 G T 13: 4,194,169 V74L probably benign Het
Amt G A 9: 108,301,451 V389I possibly damaging Het
Ankrd26 T C 6: 118,558,996 N159S probably benign Het
Atp1a4 A G 1: 172,232,005 I840T probably damaging Het
Capn1 T C 19: 5,990,334 probably null Het
Col27a1 T C 4: 63,331,427 probably benign Het
Cyp2j5 A G 4: 96,659,507 L166P probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dchs1 G A 7: 105,755,658 T2559I probably damaging Het
Dnah12 C A 14: 26,850,926 S258* probably null Het
Dpep1 A T 8: 123,200,438 T309S probably benign Het
Epha5 A T 5: 84,150,358 F559L probably damaging Het
Gm3409 T C 5: 146,537,761 I29T possibly damaging Het
Grhl1 CAGAAGAAG CAGAAG 12: 24,612,179 probably benign Het
Gtf3c1 G T 7: 125,668,037 R941S probably damaging Het
Helb C T 10: 120,105,743 E347K probably benign Het
Ighv14-3 A G 12: 114,060,090 S36P probably damaging Het
Klrb1c T A 6: 128,783,707 M211L probably benign Het
Larp7 C T 3: 127,540,811 E510K probably damaging Het
Lrig1 C T 6: 94,628,044 R190Q possibly damaging Het
March6 A G 15: 31,461,994 S863P possibly damaging Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1138 A T 2: 87,737,405 S306R probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr804 T C 10: 129,705,508 V210A probably benign Het
Papln A T 12: 83,771,882 probably null Het
Poteg C T 8: 27,481,643 S395L possibly damaging Het
Prox1 T A 1: 190,147,053 I643F possibly damaging Het
Sept4 A G 11: 87,589,245 E211G probably damaging Het
Serpinb6e A G 13: 33,832,485 F422L probably damaging Het
Slc22a19 A G 19: 7,711,138 L19P probably damaging Het
Snf8 G T 11: 96,043,460 A136S probably benign Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spta1 A G 1: 174,247,434 T2409A probably damaging Het
Tat A G 8: 109,996,818 S313G probably benign Het
Tep1 A T 14: 50,837,398 C1785* probably null Het
Tmem132b A G 5: 125,622,925 S176G probably damaging Het
Tnfrsf8 T C 4: 145,303,105 R42G possibly damaging Het
Trio T C 15: 27,754,029 D2124G possibly damaging Het
Trp53bp1 A T 2: 121,216,117 D1067E probably benign Het
Tspan13 T C 12: 36,024,066 S24G probably damaging Het
Zdbf2 T C 1: 63,304,903 S814P possibly damaging Het
Zfp213 C A 17: 23,561,399 R49L probably damaging Het
Other mutations in Mgst2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Mgst2 APN 3 51682578 missense probably benign 0.00
IGL01712:Mgst2 APN 3 51664571 missense probably damaging 1.00
IGL03401:Mgst2 APN 3 51664512 missense possibly damaging 0.89
R0294:Mgst2 UTSW 3 51681830 missense probably damaging 1.00
R2867:Mgst2 UTSW 3 51664533 synonymous silent
R4394:Mgst2 UTSW 3 51664528 missense probably damaging 1.00
R5878:Mgst2 UTSW 3 51661230 utr 5 prime probably benign
R6703:Mgst2 UTSW 3 51664612 critical splice donor site probably null
R7946:Mgst2 UTSW 3 51677570 missense probably damaging 1.00
Z1177:Mgst2 UTSW 3 51661270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGAGCAGTCCAGCATC -3'
(R):5'- GAGCCACCATTGGGAAACTC -3'

Sequencing Primer
(F):5'- GCATCGAGCAGCCTTTACCAG -3'
(R):5'- TTCTCAAGCAGAGGCCAGGTTC -3'
Posted On2016-06-21