Incidental Mutation 'R5149:Col27a1'
ID395237
Institutional Source Beutler Lab
Gene Symbol Col27a1
Ensembl Gene ENSMUSG00000045672
Gene Namecollagen, type XXVII, alpha 1
Synonyms
MMRRC Submission 042732-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5149 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location63214004-63334991 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 63331427 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036300] [ENSMUST00000183913] [ENSMUST00000184067]
Predicted Effect unknown
Transcript: ENSMUST00000036300
AA Change: F1773S
SMART Domains Protein: ENSMUSP00000043816
Gene: ENSMUSG00000045672
AA Change: F1773S

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
TSPN 43 223 1.1e-5 SMART
low complexity region 325 343 N/A INTRINSIC
low complexity region 356 372 N/A INTRINSIC
low complexity region 428 443 N/A INTRINSIC
low complexity region 455 467 N/A INTRINSIC
low complexity region 584 597 N/A INTRINSIC
Pfam:Collagen 609 670 2.1e-10 PFAM
Pfam:Collagen 666 731 3.7e-10 PFAM
low complexity region 790 808 N/A INTRINSIC
low complexity region 817 838 N/A INTRINSIC
low complexity region 858 880 N/A INTRINSIC
low complexity region 886 910 N/A INTRINSIC
low complexity region 912 946 N/A INTRINSIC
Pfam:Collagen 1012 1080 2.8e-8 PFAM
Pfam:Collagen 1033 1103 3e-9 PFAM
Pfam:Collagen 1063 1130 3.4e-9 PFAM
low complexity region 1150 1168 N/A INTRINSIC
Pfam:Collagen 1207 1281 5.5e-9 PFAM
Pfam:Collagen 1261 1324 8.4e-10 PFAM
Pfam:Collagen 1323 1384 3.8e-12 PFAM
low complexity region 1438 1466 N/A INTRINSIC
internal_repeat_4 1467 1502 1.5e-7 PROSPERO
internal_repeat_2 1468 1529 1.96e-8 PROSPERO
Pfam:Collagen 1544 1606 2.4e-9 PFAM
COLFI 1644 1845 1.28e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151992
Predicted Effect probably benign
Transcript: ENSMUST00000183913
SMART Domains Protein: ENSMUSP00000139182
Gene: ENSMUSG00000045672

DomainStartEndE-ValueType
Pfam:Collagen 1 60 2.7e-12 PFAM
Pfam:Collagen 34 114 6.6e-8 PFAM
Pfam:Collagen 87 163 3.6e-9 PFAM
low complexity region 175 202 N/A INTRINSIC
low complexity region 214 232 N/A INTRINSIC
Pfam:Collagen 271 338 9.1e-11 PFAM
Pfam:Collagen 328 388 5.4e-11 PFAM
Pfam:Collagen 387 442 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184067
SMART Domains Protein: ENSMUSP00000139173
Gene: ENSMUSG00000045672

DomainStartEndE-ValueType
Pfam:Collagen 23 87 2.1e-8 PFAM
Pfam:Collagen 57 145 8.3e-8 PFAM
Pfam:Collagen 115 200 9.9e-8 PFAM
low complexity region 202 223 N/A INTRINSIC
low complexity region 243 265 N/A INTRINSIC
low complexity region 271 295 N/A INTRINSIC
low complexity region 297 331 N/A INTRINSIC
internal_repeat_1 337 442 5.17e-20 PROSPERO
Pfam:Collagen 448 515 1.5e-9 PFAM
Pfam:Collagen 478 543 2e-10 PFAM
Pfam:Collagen 502 566 2.5e-9 PFAM
Pfam:Collagen 532 617 4.4e-7 PFAM
Pfam:Collagen 594 660 8.2e-11 PFAM
Pfam:Collagen 649 709 1.4e-10 PFAM
Pfam:Collagen 708 769 2e-12 PFAM
Pfam:Collagen 752 829 5e-8 PFAM
Pfam:Collagen 878 939 2.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXVII collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein forms a homotrimeric triple helical procollagen that undergoes proteolytic processing during fibril formation. Transgenic mice lacking a portion of the collagenous domain in the encoded protein exhibit skeletal abnormalities, chondrodysplasia and die at birth because of a lung defect. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an in frame deletion display neonatal lethality, respiratory failure, and severe chondrodysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsg A G 16: 22,898,923 T245A probably benign Het
Akr1c13 G T 13: 4,194,169 V74L probably benign Het
Amt G A 9: 108,301,451 V389I possibly damaging Het
Ankrd26 T C 6: 118,558,996 N159S probably benign Het
Atp1a4 A G 1: 172,232,005 I840T probably damaging Het
Capn1 T C 19: 5,990,334 probably null Het
Cyp2j5 A G 4: 96,659,507 L166P probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dchs1 G A 7: 105,755,658 T2559I probably damaging Het
Dnah12 C A 14: 26,850,926 S258* probably null Het
Dpep1 A T 8: 123,200,438 T309S probably benign Het
Epha5 A T 5: 84,150,358 F559L probably damaging Het
Gm3409 T C 5: 146,537,761 I29T possibly damaging Het
Grhl1 CAGAAGAAG CAGAAG 12: 24,612,179 probably benign Het
Gtf3c1 G T 7: 125,668,037 R941S probably damaging Het
Helb C T 10: 120,105,743 E347K probably benign Het
Ighv14-3 A G 12: 114,060,090 S36P probably damaging Het
Klrb1c T A 6: 128,783,707 M211L probably benign Het
Larp7 C T 3: 127,540,811 E510K probably damaging Het
Lrig1 C T 6: 94,628,044 R190Q possibly damaging Het
March6 A G 15: 31,461,994 S863P possibly damaging Het
Mgst2 A G 3: 51,682,537 N132S probably benign Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1138 A T 2: 87,737,405 S306R probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr804 T C 10: 129,705,508 V210A probably benign Het
Papln A T 12: 83,771,882 probably null Het
Poteg C T 8: 27,481,643 S395L possibly damaging Het
Prox1 T A 1: 190,147,053 I643F possibly damaging Het
Sept4 A G 11: 87,589,245 E211G probably damaging Het
Serpinb6e A G 13: 33,832,485 F422L probably damaging Het
Slc22a19 A G 19: 7,711,138 L19P probably damaging Het
Snf8 G T 11: 96,043,460 A136S probably benign Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Spta1 A G 1: 174,247,434 T2409A probably damaging Het
Tat A G 8: 109,996,818 S313G probably benign Het
Tep1 A T 14: 50,837,398 C1785* probably null Het
Tmem132b A G 5: 125,622,925 S176G probably damaging Het
Tnfrsf8 T C 4: 145,303,105 R42G possibly damaging Het
Trio T C 15: 27,754,029 D2124G possibly damaging Het
Trp53bp1 A T 2: 121,216,117 D1067E probably benign Het
Tspan13 T C 12: 36,024,066 S24G probably damaging Het
Zdbf2 T C 1: 63,304,903 S814P possibly damaging Het
Zfp213 C A 17: 23,561,399 R49L probably damaging Het
Other mutations in Col27a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Col27a1 APN 4 63300741 splice site probably benign
IGL01461:Col27a1 APN 4 63224243 missense probably damaging 1.00
IGL01534:Col27a1 APN 4 63225782 missense probably benign 0.12
IGL01738:Col27a1 APN 4 63263779 splice site probably benign
IGL01810:Col27a1 APN 4 63225631 missense probably benign 0.21
IGL02127:Col27a1 APN 4 63225142 missense possibly damaging 0.60
IGL02290:Col27a1 APN 4 63225926 missense probably damaging 1.00
IGL02374:Col27a1 APN 4 63293249 missense possibly damaging 0.86
IGL02548:Col27a1 APN 4 63318255 splice site probably benign
IGL02792:Col27a1 APN 4 63315583 missense unknown
IGL02931:Col27a1 APN 4 63331426 utr 3 prime probably benign
IGL03107:Col27a1 APN 4 63324632 splice site probably benign
IGL03121:Col27a1 APN 4 63225209 missense probably benign 0.26
IGL03334:Col27a1 APN 4 63314722 missense probably damaging 1.00
R0005:Col27a1 UTSW 4 63225400 missense probably benign 0.04
R0025:Col27a1 UTSW 4 63275977 missense probably damaging 1.00
R0141:Col27a1 UTSW 4 63265633 critical splice acceptor site probably null
R0196:Col27a1 UTSW 4 63224266 missense probably benign 0.02
R0359:Col27a1 UTSW 4 63314727 critical splice donor site probably null
R0375:Col27a1 UTSW 4 63225661 missense probably benign 0.23
R0432:Col27a1 UTSW 4 63225611 missense possibly damaging 0.87
R0499:Col27a1 UTSW 4 63300741 splice site probably benign
R0786:Col27a1 UTSW 4 63291578 critical splice donor site probably null
R0891:Col27a1 UTSW 4 63305183 critical splice acceptor site probably null
R1239:Col27a1 UTSW 4 63318915 splice site probably benign
R1297:Col27a1 UTSW 4 63265631 splice site probably benign
R1299:Col27a1 UTSW 4 63265631 splice site probably benign
R1322:Col27a1 UTSW 4 63328566 utr 3 prime probably benign
R1342:Col27a1 UTSW 4 63257114 critical splice donor site probably null
R1446:Col27a1 UTSW 4 63224803 missense probably damaging 1.00
R1629:Col27a1 UTSW 4 63329863 utr 3 prime probably benign
R1644:Col27a1 UTSW 4 63328631 utr 3 prime probably benign
R1774:Col27a1 UTSW 4 63225713 missense probably damaging 1.00
R1807:Col27a1 UTSW 4 63331349 utr 3 prime probably benign
R1952:Col27a1 UTSW 4 63283893 splice site probably null
R1957:Col27a1 UTSW 4 63277794 missense probably benign 0.03
R1970:Col27a1 UTSW 4 63273117 splice site probably benign
R2164:Col27a1 UTSW 4 63225424 missense probably benign 0.21
R3774:Col27a1 UTSW 4 63314726 missense probably benign 0.00
R4078:Col27a1 UTSW 4 63224432 missense probably damaging 1.00
R4353:Col27a1 UTSW 4 63225631 missense probably benign 0.21
R4611:Col27a1 UTSW 4 63293506 missense probably damaging 1.00
R4708:Col27a1 UTSW 4 63283913 missense probably benign 0.01
R4884:Col27a1 UTSW 4 63275960 missense possibly damaging 0.77
R5411:Col27a1 UTSW 4 63224665 missense probably damaging 1.00
R5451:Col27a1 UTSW 4 63225239 missense probably damaging 0.98
R5615:Col27a1 UTSW 4 63281114 missense probably damaging 0.96
R5657:Col27a1 UTSW 4 63225310 missense probably damaging 0.97
R5838:Col27a1 UTSW 4 63225528 missense probably damaging 1.00
R6230:Col27a1 UTSW 4 63224282 missense probably damaging 1.00
R6326:Col27a1 UTSW 4 63324441 utr 3 prime probably benign
R6457:Col27a1 UTSW 4 63319464 utr 3 prime probably benign
R6624:Col27a1 UTSW 4 63225011 missense probably benign 0.00
R6792:Col27a1 UTSW 4 63317503 missense unknown
R6848:Col27a1 UTSW 4 63302371 missense probably benign
R6962:Col27a1 UTSW 4 63319501 utr 3 prime probably benign
R7053:Col27a1 UTSW 4 63333167 utr 3 prime probably benign
R7206:Col27a1 UTSW 4 63235346 missense probably benign 0.29
R7586:Col27a1 UTSW 4 63225041 missense probably damaging 1.00
R7698:Col27a1 UTSW 4 63225718 missense possibly damaging 0.78
R7714:Col27a1 UTSW 4 63324486 critical splice donor site probably null
R7916:Col27a1 UTSW 4 63224552 missense probably damaging 1.00
R7943:Col27a1 UTSW 4 63318283 missense unknown
R7988:Col27a1 UTSW 4 63331322 missense unknown
R8136:Col27a1 UTSW 4 63283953 missense probably benign 0.06
R8243:Col27a1 UTSW 4 63225883 missense probably damaging 1.00
R8245:Col27a1 UTSW 4 63225803 missense probably damaging 0.97
R8350:Col27a1 UTSW 4 63329897 missense unknown
R8437:Col27a1 UTSW 4 63319464 utr 3 prime probably benign
R8450:Col27a1 UTSW 4 63329897 missense unknown
R8542:Col27a1 UTSW 4 63321425 splice site probably null
R8745:Col27a1 UTSW 4 63225916 missense probably benign 0.02
R8821:Col27a1 UTSW 4 63224911 missense probably benign 0.04
R8951:Col27a1 UTSW 4 63273074 missense possibly damaging 0.92
Z1176:Col27a1 UTSW 4 63225788 missense probably damaging 0.99
Z1177:Col27a1 UTSW 4 63281289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAGGGCTTACTTACCCC -3'
(R):5'- CACACCGAGAATGCCTAGAG -3'

Sequencing Primer
(F):5'- GGCTTACTTACCCCGGTGC -3'
(R):5'- TGCCTAGAGAAGGGAGTAAAGTC -3'
Posted On2016-06-21